NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss

LIU Shuang Yan SONG Wei Qin XIN Jia Rui LI Zheng LEI Song CHEN Ying Qi ZHAO Tian Yu WANG Hai Yan XU Liang Wen ZHANG Mei Bian HONG Yu YANG Lei

LIU Shuang Yan, SONG Wei Qin, XIN Jia Rui, LI Zheng, LEI Song, CHEN Ying Qi, ZHAO Tian Yu, WANG Hai Yan, XU Liang Wen, ZHANG Mei Bian, HONG Yu, YANG Lei. NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss[J]. Biomedical and Environmental Sciences, 2021, 34(9): 705-718. doi: 10.3967/bes2021.098
Citation: LIU Shuang Yan, SONG Wei Qin, XIN Jia Rui, LI Zheng, LEI Song, CHEN Ying Qi, ZHAO Tian Yu, WANG Hai Yan, XU Liang Wen, ZHANG Mei Bian, HONG Yu, YANG Lei. NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss[J]. Biomedical and Environmental Sciences, 2021, 34(9): 705-718. doi: 10.3967/bes2021.098

doi: 10.3967/bes2021.098

NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss

Funds: This work was supported by Zhejiang Key Research and Development Program of China [No.2015C03039; No.20152013A01]; Zhejiang Provincial Program for the Cultivation of High-level Innovative Health Talents, China; Zhejiang Health Innovative Talent Training Project of China, general scientific research project of Zhejiang Science and Technology Department of China [No. Y201941671]; and Natural Science Foundation of Zhejiang Provincial, China [LY18H260002]
More Information
    Author Bio:

    LIU Shuang Yan, female, born in 1994, Master’s Degree, majoring in occupational noise induced hearing loss

    SONG Wei Qin, female, born in 1992, Master’s Degree, majoring in sensorineural hearing loss

    Corresponding author: ZHANG Mei Bian, E-mail: mbzhang@cdc.zj.cnHONG Yu, E-mail: hongyu_xj@126.comYANG Lei, Tel: 86-571-28865010, Fax: 86-571-28865000, E-mail: yanglei62@hznu.edu.cn
  • &These authors contributed equally to this work.
    • 关键词:
    •  / 
    •  / 
    •  / 
    •  / 
    •  / 
    •  / 
    •  
    &These authors contributed equally to this work.
    注释:
  • S2.  Interactions of NRN1 rs3805789, CAT rs7943316 and kurtosis associated with NIHL risk identified by GMDR

    S1.  Interactions of NRN1 rs3805789 and CAT rs7943316 associated with NIHL risk identified by GMDR

    Figure  1.  Stratified analysis for gene–gene interaction on NIHL risk using logistic regression.

    The odds ratios (ORs) were calculated after adjustment for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE, smoking, video volume, physical exercise, and working pressure. 1: rs3805789-CC and rs7943316-AA; 2: rs3805789-CC and rs7943316-AT; 3: rs3805789-CT and rs7943316-AA; 4: rs3805789-CT and rs7943316-TT; 5: rs3805789-CT/TT and rs7943316-AA; 6: rs3805789-CC and rs7943316-AA/TT.

    Figure  2.  Joint effects of the NRN1 rs3805789 and CAT rs7943316 with kurtosis on NIHL risk. The reference group was defined as subjects exposed steady-state noise who carry NRN1 rs3805789 CC and CAT rs7943316 AA. Ref: reference group. The odds ratios (ORs) were calculated by the logistic regression analysis after adjustment for age, gender, education, years of exposure, smoking, video volume, physical exercise, and working pressure.

    Table  1.   Basic information for 18 SNPs

    SNP IDGeneChromosomePositionFunction Alleles
    rs1049216CASP341846289353 Prime UTR VariantG/A
    rs6948CASP341846279763 Prime UTR VariantT/G
    rs3805789NRN166003752Intron Variant, 5 Prime UTR VariantC/T
    rs2227956HSPA1L631810495Missense VariantG/A, C, T
    rs1043618HSPA1A/HSPA1L6318157305 Prime UTR Variant, 2KB Upstream VariantG/A, C, T
    rs2763979HSPA1B6318268152KB Upstream VariantC/T
    rs3749930NOX36155440112Missense VariantG/T
    rs12665231NOX361553954633 Prime UTR VariantT/C
    rs12195525NOX36155454846Stop Gained, Synonymous VariantG/A, T
    rs3752752CDH231071695444Synonymous VariantT/C
    rs3802711CDH231071784329Missense VariantG/A
    rs1227049CDH231071675131Missense VariantG/A, C, T
    rs12415607CASP7101136784452KB Upstream VariantC/A
    rs1127687CASP7101137303503 Prime UTR VariantG/A
    rs564250CAT11344373142KB Upstream VariantT/A, C
    rs769214CAT11344381702KB Upstream VariantG/A
    rs769217CAT1134461361Synonymous VariantC/T
    rs7943316CAT11344389252KB Upstream VariantA/T
      Note. CASP3: Caspase3; NRN1: Neuritin1; HSP: Heat shock protein; NOX3: NADPH Oxidase3; CDH23: Cadherin-23; CASP7: Caspase7; CAT: Catalase.
    下载: 导出CSV

    S1.   Primer information A

    SNP IDPrimer Allele FAMPrimer Allele HEXPrimer Common
    rs1049216AGTAATTGTGAAAAAGTTAAACATTGAAGTAATAGTAATTGTGAAAAAGTTAAACATTGAACCAGTCTTAAGTGGGGGGAATATCATAAAA
    rs6948GGAGGCCAGAGCTGAGCCCGGAGGCCAGAGCTGAGCAAGCCTGCCTCCCGGGCTGA
    rs3805789TTCCGCCCTGAGGCCGACCTTTCCGCCCTGAGGCCGATCACTCAGCTTCCAGCCGGGTT
    rs2227956ATGGTATTCTCAATGTCACAGCCACAATGGTATTCTCAATGTCACAGCCATCTTGTTCACCTTGCCGGTGCTCTT
    rs1043618CCTGCTCTCTGTCGGCTCCCCTGCTCTCTGTCGGCTCGGTGTTCCGTTTCCAGCCCCCAA
    rs2763979ATTCCTGGTTCACTCCTGGACGAATTCCTGGTTCACTCCTGGACACTCGGGACTGTGAGGTCCTACTT
    rs3749930ACACAACCACTGAATTGCTAAGGACAACACAACCACTGAATTGCTAAGGAACAGACCGGTGACGCCTGCTATT
    rs12665231AGCTAAGGAAGTATGGTATAGTGTACTGCTAAGGAAGTATGGTATAGTGTACCCCCAGTTGGGAACTGGTGAATAATAATTA
    rs12195525GTTCCTCTTATGAATGAAATAAGGTTTCAGTTCCTCTTATGAATGAAATAAGGTTTCGCTGTGCCTGAATTTTAACTGCATGCTAAT
    rs3752752AAACATCACCCTCCTGGACATCAATCATCACCCTCCTGGACATCAACGTCCTTCCACGTGGGGTGGTT
    rs3802711GTCCAGCTCCACGTCCTTCCGGTCCAGCTCCACGTCCTTCTTCTCCTGTGGAGGGGGTGCTAA
    rs1227049AGCTGACTTCCCCAAAGGTGGAGCTGACTTCCCCAAAGGTGCGCTGTTGCAGGCAACTGACAATGAT
    rs12415607AATGGAGTACATGCTTAGTGGTCGGAATGGAGTACATGCTTAGTGGTCTAGAAGATGGCGTTCTTGCCTGGTAT
    rs1127687CACTCCATCTCAGTCAGTGGCCTCACTCCATCTCAGTCAGTGGTTGGAAAATGGAGCCATGACAAGAACAAA
    rs564250AGACCTGGAGTCATTTCTTAACCTTTAGACCTGGAGTCATTTCTTAACCTTTGCAAATCCATAGTAACAAAAACAAAGGAAAA
    rs769214TTTCAAAATTCCTGCTTACCTGGGATCAAAATTCCTGCTTACCTGGGGACTGGAGAAATCTGCTTCCCCAAATTTTA
    rs769217GTGGCCAACTACCAGCGTGACAGTGGCCAACTACCAGCGTGATTACCCTGATTGTCCTGCATGCACAT
    rs7943316AAATCTGCCTGTTGCCCCGAGTAAATCTGCCTGTTGCCCCGAGAGGTGCTGATTGGCTGAGCCTGAA
    下载: 导出CSV

    S2.   Primer information B

    SNP IDSequenceCG%_FAMCG%_HEXCG% Common
    rs1049216GGGGAATATCATAAAAATTC[A/G] TTACTTCAATGTTTAACTTT21.224.237.9
    rs6948AGCCTGCCTCCCGGGCTGAG[G/T] GCTCAGCTCTGGCCTCCGGC72.268.473.7
    rs3805789TCTTTCCGCCCTGAGGCCGA[C/T] GAACCCGGCTGGAAGCTGAG7061.961.9
    rs2227956TATTCTCAATGTCACAGCCA[C/T] GGACAAGAGCACCGGCAAGG4438.554.2
    rs1043618CCAGCCCCCAATCTCAGAGC[C/G] GAGCCGACAGAGAGCAGGGA68.468.459.1
    rs2763979GAGGTCCTACTTCTACACAC[C/T] GTCCAGGAGTGAACCAGGAA54.547.856.5
    rs3749930GACCGGTGACGCCTGCTATT[G/T] TCCTTAGCAATTCAGTGGTT4438.559.1
    rs12665231GGAAGTATGGTATAGTGTAC[T/C] GTTCACAATAGTTAATTATT3742.337.9
    rs12195525TATGAATGAAATAAGGTTTC[A/G] ACTGACAGGTATTAGAATTA3032.337.9
    rs3752752ATCACCCTCCTGGACATCAA[T/C] GACAACCACCCCACGTGGAA42.354.561.9
    rs3802711GGAGGGGGTGCTAAGGGTCC[G/A] GAAGGACGTGGAGCTGGACC6561.959.1
    rs1227049GGCAACTGACAATGATGCAG[C/G] CACCTTTGGGGAAGTCAGCT54.554.548
    rs12415607TGGCGTTCTTGCCTGGTATC[C/A] GACCACTAAGCATGTACTCC45.842.348
    rs1127687GGAGCCATGACAAGAACAAA[G/A] CCACTGACTGAGATGGAGTG58.352.239.3
    rs564250GCTTTTTTTTATATAATGAA[C/T] AAAGGTTAAGAAATGACTCC3742.326.7
    rs769214AAAATTCCTGCTTACCTGGG[A/G] GTAAAATTTGGGGAAGCAGA49.24437.9
    rs769217GTGGCCAACTACCAGCGTGA[C/T] GGCCCGATGTGCATGCAGGA61.954.548
    rs7943316GAGCCTGAAGTCGCCACGGA[A/T] CTCGGGGCAACAGGCAGATT54.554.556.5
    下载: 导出CSV

    Table  2.   General characteristics of subjects between NIHL and control groups

    CharacteristicsTotal (n = 614)NIHL (n = 307)Control (n = 307)χ2/zP
    Sex, n (%)
     Male474 (77.2)237 (38.6)237 (38.6)0.0001.000
     Female140 (22.8)70 (11.4)70 (11.4)
    Age, y35 (30–43)36 (30–43)34 (30–42)−1.9590.050
    Education, n (%)
     High school and above347 (56.5)168 (27.4)179 (29.2)0.8020.371
     Junior high school and below267 (43.5)139 (22.6)128 (20.8)
    Type of work, n (%)
    Packing worker/
    Coating worker/
    Electric welder
    69 (11.2)/
    19 (3.1)/ 34 (5.5)
    32 (5.2)/
    13 (2.1)/19 (3.1)
    37 (6.0)/
    6 (1.0)/15 (2.4)
    __
     Fitter/Machinist85 (13.8)/101 (16.4)42 (6.8)/48 (7.8)43 (7.0)/53 (8.6)
    Wire drawing worker/
    Cold heading workers/
    Silk knead worker
    25 (4.1)/
    79 (12.9)/50 (8.2)
    14 (2.3)/
    28 (4.6)/22 (3.6)
    11 (1.8)/
    51 (8.3)/28 (4.6)
    Grinder/Heat-treater/
    Punching worker
    27(4.4)/
    17 (2.8)/24 (3.9)
    12 (2.0)/
    9 (1.5)/10 (1.6)
    15 (2.4)/
    8 (1.3)/14 (2.3)
     Others84 (13.7)58 (9.5)26 (4.2)
    Years of noise exposure, y3.00
    (1.43–6.00)
    3.00
    (1.20–6.00)
    3.00
    (2.00–6.00)
    −1.0020.317
    HTL346, dB25.00
    (17.83–36.96)
    36.83
    (29.83–49.83)
    17.83
    (14.17–21.00)
    −21.442< 0.001
    Kurtosis, median (P25–P75)6.62
    (4.28–13.15)
    7.25
    (4.63–14.30)
    5.85
    (4.06–12.51)
    −2.7550.006
     < 4114 (18.6)47 (7.7)67 (10.9)4.0390.038
     ≥ 4500 (81.4)260 (42.3)240 (39.1)
    CNE, median (P25–P75), dB(A)93.69
    (89.48–97.57)
    93.73
    (89.67–98.24)
    93.62
    (89.07–96.88)
    −1.230.219
     < 97.1420449 (73.1)213 (34.7)236 (38.4)4.3840.036
     ≥ 97.1420165 (26.9)94 (15.3)71 (11.6)
    Adj-CNE, median (P25–P75), dB(A)94.89
    (90.02–99.23)
    95.34
    (90.20–99.61)
    94.61
    (89.75–98.59)
    −1.5640.118
     < 96.9939387 (63.0)178 (29.0)209 (34.0)6.7170.010
     ≥ 96.9939227 (37.0)129 (21.0)98 (16.0)
    Smoking, n (%)
     No325 (52.9)150 (24.4)175 (28.5)4.0860.043
     Yes289 (47.1)157 (25.6)132 (21.5)
    Video volume, n (%)
     Low149 (24.3)60 (9.8)89 (14.5)7.4530.006
     High465 (75.7)247 (40.2)218 (35.5)
    Physical exercise, n (%)
     Never418 (68.1)224 (36.5)194 (31.6)6.7450.009
     Regular196 (31.9)83 (13.5)113 (18.4)
    Working pressure, n (%)
     Low113 (18.4)49 (8.0)64 (10.4)2.4400.118
     High501 (81.6)258 (42.0)243 (39.6)
    下载: 导出CSV

    Table  3.   The genotype and allele frequencies of 18 SNPs in NIHL cases and control subjects

    SNP IDGeneGroupGenotype (frequency %)Allele (frequency %)POR (95% CI)MAFaMAFbHWE P
    rs1049216CASP3AAAGGGAG
    Case10 (3.3)105 (34.2)192 (62.5)125 (20.4)489 (79.6)0.0461.046
    (1.005–1.802)
    0.4030.1600.616
    Control9 (2.9)80 (26.1)218 (71.0)98 (16.0)516 (84.0)
    rs6948CASP3GGGTTTGT
    Case10 (3.3)92 (30.0)205 (66.8)112 (18.2)502 (81.8)0.0641.334
    (0.982–1.809)
    0.4260.1430.431
    Control8 (2.6)72 (23.5)227 (73.9)88 (14.3)526 (85.7)
    rs3805789NRN1CCCTTTCT
    Case84 (27.4)163 (53.1)60 (19.5)331 (53.9)283 (46.1)0.8641.020
    (0.815–1.276)
    0.3000.4660.216
    Control93 (30.3)142 (46.3)72 (23.5)328 (53.4)286 (46.6)
    rs2227956HSPA1LCCCTTTCT
    Case15 (4.9)86 (28.0)206 (67.1)116 (18.9)498 (81.1)0.9420.989
    (0.744–1.316)
    0.1230.1910.671
    Control10 (3.3)97 (31.6)200 (65.1)117 (19.1)497 (80.9)
    rs1043618HSPA1A/
    HSPA1L
    CCCGGGCG
    Case42 (13.7)118 (38.4)147 (47.9)202 (32.9)412 (67.1)0.9030.985
    (0.777–1.250)
    0.4810.3320.587
    Control36 (11.7)132 (43.0)139 (45.3)204 (33.2)410 (66.8)
    rs2763979HSPA1BCCCTTTCT
    Case168 (54.7)102 (33.2)37 (12.1)438 (71.3)176 (28.7)0.4531.098
    (0.860–1.403)
    0.4480.3060.387
    Control151 (49.2)124 (40.4)32 (10.4)426 (69.4)188 (30.6)
    rs3749930NOX3GGGTTTGT
    Case86 (28.0)148 (48.2)73 (23.8)320 (52.1)294 (47.9)0.1231.192
    (0.953–1.492)
    0.1970.4770.662
    Control68 (22.1)157 (51.1)82 (26.7)293 (47.7)321 (52.3)
    rs12665231NOX3CCCTTTCT
    Case23 (7.5)100 (32.6)184 (59.9)146 (23.8)468 (76.2)0.8410.974
    (0.749–1.265)
    0.1880.2430.126
    Control23 (7.5)103 (33.6)181 (59.0)149 (24.3)465 (75.7)
    rs12195525NOX3GGTGTTGT
    Case267 (87.0)35 (11.4)5 (1.6)569 (92.7)45 (7.3)0.0571.471
    (0.987–2.193)
    0.1290.1040.103
    Control249 (81.1)52 (16.9)6 (2.0)550 (89.6)64 (10.4)
    rs3752752CDH23CCTCTTCT
    Case84 (27.4)142 (46.3)81 (26.4)310 (50.5)304 (49.5)0.9540.994
    (0.794–1.243)
    0.4450.4930.154
    Control85 (27.7)141 (45.9)81 (26.4)311 (50.7)303 (49.3)
    rs3802711CDH23AACACCAC
    Case19 (6.2)107 (34.9)181 (59.0)145 (23.6)469 (76.4)0.3051.151
    (0.880–1.506)
    0.1390.2120.345
    Control11 (3.6)108 (35.2)188 (61.2)130 (21.2)484 (78.8)
    rs1227049CDH23CCCGGGCG
    Case37 (12.1)127 (41.4)143 (46.6)201 (32.7)413 (67.3)0.3251.129
    (0.887–1.436)
    0.1850.3010.612
    Control26 (8.5)133 (43.3)148 (48.2)185 (30.1)429 (69.9)
    rs12415607CASP7AACACCAC
    Case51 (16.6)155 (50.5)101 (32.9)257 (41.90357 (58.1)0.0351.280
    (1.017–1.611)
    0.2680.3600.237
    Control35 (11.4)151 (49.2)121 (39.4)221 (36.0)393 (64.0)
    rs1127687CASP7AAGAGGAG
    Case17 (5.5)94 (30.6)196 (63.8)128 (20.8)486 (79.2)0.1030.801
    (0.613–1.046)
    0.2300.2480.955
    Control19 (5.5)114 (37.1)174 (56.7)152 (24.8)462 (75.2)
    rs564250CATCCTCTTCT
    Case195 (63.5)92 (30.0)20 (6.5)482 (78.5)132 (21.5)0.6230.933
    (0.709–1.229)
    0.2120.2040.249
    Control198 (64.5)93 (30.3)16 (5.2)489 (79.6)125 (20.4)
    rs769214CATAAAGGGAG
    Case31 (10.1)120 (39.1)156 (50.8)182 (29.6)432 (70.4)0.8520.977
    (0.765–1.247)
    0.4730.3010.972
    Control28 (9.1)129 (42.0)150 (48.9)185 (30.1)429 (69.9)
    rs769217CATCCCTTTCT
    Case83 (27.0)148 (48.2)76 (24.8)314 (51.1)300 (48.9)0.8641.020
    (0.815–1.275)
    0.2630.4930.333
    Control83 (27.0)145 (47.2)79 (25.7)311 (50.7)303 (49.3)
    rs7943316CATAAATTTAT
    Case160 (52.1)112 (36.5)35 (11.4)432 (70.4)182 (29.6)0.6641.056
    (0.827–1.347)
    0.4880.3080.609
    Control149 (48.5)127 (41.4)31 (10.1)425 (69.2)189 (30.8)
      Note. MAF: Minor allele frequency; HWE: Hardy–Weinberg equilibrium; a1000 genomes; bData form this study; OR: odds ratio; CI: confidence interval. P-values of deviation from HWE between the NIHL group and control group.
    下载: 导出CSV

    Table  4.   Association of multidimensional gene-gene interactions of 18 SNPs with NIHL risk

    No. of lociModelTRBATEBAP valueCVC
    1X10.54800.51127 (0.1719)8/10
    2X3 X180.59210.57719 (0.0107)10/10
    3X3 X10 X160.61860.51166 (0.3770)3/10
    4X3 X8 X10 X180.66620.45912 (0.9893)2/10
    5X3 X6 X10 X13 X170.73920.46504 (0.8281)3/10
    6X3 X5 X10 X12 X13 X170.82900.52187 (0.1719)8/10
    7X3 X5 X7 X10 X11 X12 X170.90600.55386 (0.3770)9/10
    8X3 X5 X7 X10 X11 X12 X13 X170.95270.43512 (0.9893)4/10
    9X3 X4 X5 X7 X8 X10 X12 X13 X170.9927NaN4 (0.8281)4/10
    10X3 X4 X5 X7 X8 X10 X11 X12 X13 X170.9926NaN4 (0.8281)3/10
    11X2 X3 X4 X5 X6 X7 X8 X11 X12 X14 X170.9981NaN3 (0.9453)1/10
    12X1 X3 X4 X5 X6 X7 X8 X10 X12 X13 X14 X171.0000NaN2 (0.9893)1/10
    13X1 X2 X3 X4 X5 X7 X8 X9 X11 X12 X14 X16 X171.0000NaN3 (0.9453)2/10
    14X1 X2 X3 X4 X5 X6 X7 X8 X9 X11 X12 X14 X16 X171.0000NaN4 (0.8281)4/10
    15X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X181.0000NaN2 (0.9893)8/10
    16X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X15 X181.0000NaN0 (1.0000)8/10
    17X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X15 X16 X171.0000N/A0 (1.0000)10/10
    18X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X15 X16 X17 X181.0000N/A0 (1.0000)10/10
      Note. P-values were obtained from the GMDR analysis which adjusted for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE, smoking, video volume, physical exercise, and working pressure. TRBA: Training balanced accuracy; TEBA: Testing Balanced accuracy; CVC: cross-validation consistency; X1: CASP3 rs1049216; X2: CASP3 rs6948; X3: NRN1 rs3805789; X4: HSPA1L rs2227956; X5: HSPA1A/HSPA1L rs1043618; X6: HSPA1B rs2763979; X7: NOX3 rs3749930; X8: NOX3 rs12665231; X9: NOX3 rs12195525; X10: CDH23 rs3752752; X11: CDH23 rs3802711; X12: CDH23 rs1227049; X13: CASP7 rs12415607; X14: CASP7 rs1127687; X15: CAT rs564250; X16: CAT rs769214; X17: CAT rs769217; X18: CAT rs7943316.
    下载: 导出CSV

    S3.   Jointed effects of NRN1 and CAT on NIHL by using the logistic regression models

    NRN1CATRisk of NIHL
    rs3805789rs7943316Controls/Cases, n (%)ORs (95% CI)*PFDR
    CCAA55 (17.9)/39 (12.7)1.00
    CCAT29 (9.4)/41 (13.4)2.276 (1.171–4.427)0.0150.041
    CCTT9 (2.9)/4 (1.3)0.650 (0.173–2.442)0.5240.64
    CTAA61 (19.9)/87 (28.3)2.213 (1.273–3.849)0.0050.028
    CTAT67 (21.8)/48 (15.6)1.036 (0.578–1.857)0.9050.905
    CTTT14(4.6)/28 (9.1)3.169 (1.425–7.048)0.0050.028
    TTAA33 (10.7)/34 (11.1)1.620 (0.419–6.205)0.1540.282
    TTAT31(10.1)/23 (7.5)1.048 (0.514–2.137)0.8980.905
    TTTT8 (2.6)/3 (1.0)0.558 (0.131–2.377)0.4300.591
    CT+TTAA94 (30.6)/121 (39.4)2.005 (1.200–3.348)0.0080.029
    CCAT+TT38 (12.4)/45 (14.7)1.892 (1.008–3.550)0.0470.103
    CT+TTAT+TT120 (39.1)/102 (33.2)1.255 (0.752–2.094)0.3850.591
      Note. NRN1: neuritin 1; CAT: catalase; ORs: odds ratio; CI: confidential interval. *ORs (95% CI) and P value were obtained with the use of multivariate logistic regression analysis after adjustment for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE, smoking, video volume, physical exercise, and working pressure. FDR (false discovery rate) was obtained with the use of Benjamin-Hochberg procedure for controlling the false positive rate in multiple comparison.
    下载: 导出CSV

    Table  5.   Associations of interactions among genes, noise metrics and lifestyle factors with the risk of NIHL

    No. of lociModelTRBATEBAP valueCVC
    A. Gene–noise-metric interactiona
    1K40.53630.49075 (0.6230)4/10
    2X3 X180.59030.57629 (0.0107)10/10
    3X3 X18 K40.60030.586310 (0.0010)10/10
    4X3 X18 adj-CNE K40.61250.58569 (0.0107)10/10
    5X3 X18 adj-CNE CNE K40.61250.58569 (0.0107)10/10
    B. Gene–lifestyle-factor interactionb
    1Y30.55540.53566 (0.3770)9/10
    2X3 X180.59270.53497 (0.1719)7/10
    3X3 X18 Y40.62910.53779 (0.0107)5/10
    4X3 X18 Y1 Y30.68300.58509 (0.0107)9/10
    5X3 X18 Y1 Y3 Y40.73870.55709 (0.0107)7/10
    6X3 X18 Y1 Y2 Y3 Y40.79460.58669 (0.0010)10/10
    C. Noise-metric–lifestyle-factor interactionc
    1Y30.55430.53406 (0.3770)9/10
    2Y2 Y30.58160.52097 (0.1719)5/10
    3Y2 Y3 Y40.60690.47923 (0.9453)6/10
    4Y1 Y2 Y3 Y40.64940.55099 (0.0107)10/10
    5Y1 Y2 Y3 Y4 K40.67780.54679 (0.0107)10/10
    6Y1 Y2 Y3 Y4 K4 adj-CNE0.69700.54379 (0.0107)7/10
    7Y1 Y2 Y3 Y4 K4 adj-CNE CNE0.69200.55039 (0.0107)10/10
      Note. aAdjusted for age, gender, education, smoking, video volume, physical exercise, and working pressure; bAdjusted for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE; cAdjusted for age, gender, education; TRBA: Training balanced accuracy; TEBA: Testing Balanced accuracy; CVC: cross-validation consistency; X3: NRN1 rs3805789; X18: CAT rs7943316; K4: kurtosis; Y1: smoking; Y2: video volume; Y3: physical exercise; Y4: working pressure.
    下载: 导出CSV

    S4.   Jointed effects on NIHL between high-risk genotypes of NRN1and CAT and kurtosis

    Combination of kurtosis and genotypes of NRN1and CATControls/Cases, n (%)ORs (95% CI)*P*FDR
    Steady-state noisers3805789 CC-rs7943316 AA9 (2.9)/8 (2.6)1.000
    rs3805789 CC-rs7943316 AT6 (2.0)/9 (2.9)2.499 (0.561–11.133)0.2300.814
    rs3805789 CC-rs7943316 TT3 (1.0)/0 (0.0)0.0000.9991.000
    rs3805789 CT-rs7943316 AA19 (6.2)/14 (14.6)1.317 (0.375–4.626)0.6671.078
    rs3805789 CT-rs7943316 AT15 (4.9)/7 (2.3)0.817 (0.206–3.234)0.7730.895
    rs3805789 CT-rs7943316 TT3 (1.0)/2 (0.7)0.992 (0.122–8.078)0.9941.047
    rs3805789 TT-rs7943316 AA7 (2.3)/5 (1.6)1.289 (0.269–6.185)0.7510.987
    rs3805789 TT-rs7943316 AT4 (1.3)/2 (0.7)0.734 (0.098–5.485)0.7630.941
    rs3805789 TT-rs7943316 TT1 (0.3)/0 (0.0)0.0001.0001.000
    rs3805789 CT/TT-rs7943316 AA26 (8.5)/19 (6.2)1.273 (0.388–4.179)0.6911.013
    rs3805789 CC-rs7943316 (AT+TT)9 (2.9)/9 (2.9)1.723 (0.422–7.040)0.4491.041
    rs3805789 (CT+TT)-rs7943316 (AT+TT)23 (7.5)/11 (3.6)0.772 (0.220–2.710)0.6861.013
    Complex noisers3805789 CC-rs7943316 AA46 (15.0)/31 (10.1)1.540 (0.348–6.809)0.5691.043
    rs3805789 CC-rs7943316 AT23 (7.5)/32 (10.4)3.347 (0.740–15.139)0.1170.644
    rs3805789 CC-rs7943316 TT6 (2.0)/4 (1.3)1.336 (0.193–9.262)0.7700.895
    rs3805789 CT-rs7943316 AA42 (13.7)/73 (23.8)3.875 (0.895–16.774)0.0700.051
    rs3805789 CT-rs7943316 AT52 (16.9)/41 (13.4)1.689 (0.391–7.288)0.4830.966
    rs3805789 CT-rs7943316 TT11 (3.6)/26 (8.5)5.961(1.219–29.155)0.0280.374
    rs3805789 TT-rs7943316 AA26 (8.5)/29 (9.4)2.625 (0.581–11.864)0.2100.843
    rs3805789 TT-rs7943316 AT27 (8.8)/21 (6.8)1.750 (0.380–8.057)0.4730.966
    rs3805789 CT+TT-rs7943316 AA68 (22.1)/102 (33.2)1.607 (1.035–2.494)0.0340.051
    rs3805789 CC-rs7943316 (AT+TT)23 (9.4)/36 (11.7)1.378 (0.761–2.495)0.2900.800
    rs3805789 (CT+TT)-rs7943316 (AT+TT)97 (31.6)/91 (29.6)0.945 (0.411–1.270)0.2590.800
      Note. *ORs (95% CI) and P value were obtained with multivariate logistic regression analysis after adjustment for age, gender, education, years of exposure, smoking, video volume, physical exercise, and working pressure. FDR (false discovery rate) was obtained from the Benjamin-Hochberg procedure.
    下载: 导出CSV
  • [1] WHO. Deafness and hearing loss [online] [DB/OL]. Available at: http://www.who.int/mediacentre/factsheets/fs300/en/.
    [2] Chen YL, Hu WJ. Research progress on mechanisms of noise-induced hearingloss. Chinese J Ind Med, 2018; 31, 438−40.
    [3] Stanbury M, Rafferty AP, Rosenman K. Prevalence of hearing loss and work-related noise-induced hearing loss in Michigan. J Occup Environ Med, 2008; 50, 72−9. doi:  10.1097/JOM.0b013e31815b568c
    [4] Shargorodsky J, Curhan SG, Curhan GC, et al. Change in prevalence of hearing loss in US adolescents. JAMA, 2010; 304, 772−8. doi:  10.1001/jama.2010.1124
    [5] Lao XQ, Yu ITS, Au DKK, et al. Noise Exposure and Hearing Impairment among Chinese Restaurant Workers and Entertainment Employees in Hong Kong. Plos One, 2013; 8, e70674. doi:  10.1371/journal.pone.0070674
    [6] Frederiksen TW, Ramlau-Hansen CH, Stokholm ZA, et al. Noise-Induced Hearing Loss - A Preventable Disease? Results of a 10-Year Longitudinal Study of Workers Exposed to Occupational Noise. Noise Health, 2017; 19, 103−11.
    [7] Clark WW, Bohne BA, Boettcher FA. Effect of periodic rest on hearing loss and cochlear damage following exposure to noise. J Acoust Soc Am, 1987; 82, 1253−64. doi:  10.1121/1.395261
    [8] Erdreich J. A distribution based definition of impulse noise. J Acoust Soc Am, 1986; 79, 990−8. doi:  10.1121/1.393698
    [9] Pourbakht A, Yamasoba T. Cochlear damage caused by continuous and intermittent noise exposure. Hear Res, 2003; 178, 70−8. doi:  10.1016/S0378-5955(03)00039-X
    [10] Zhao YM, Qiu W, Zeng L, et al. Application of the kurtosis statistic to the evaluation of the risk of hearing loss in workers exposed to high-level complex noise. Ear Hear, 2010; 31, 527−32. doi:  10.1097/AUD.0b013e3181d94e68
    [11] Davis RI, Qiu W, Heyer NJ, et al. The use of the kurtosis metric in the evaluation of occupational hearing loss in workers in China: Implications for hearing risk assessment. Noise & Health, 2012; 14, 330−42.
    [12] Wang SL, Yu LG, Liu RP, et al. Gene-gene interaction of GJB2, SOD2, and CAT on occupational noise-induced hearing loss in Chinese Han population. Biomed Environ Sci, 2014; 27, 965−8.
    [13] Yang JH, Zhang JY, Wang XM, et al. Identification of functional tag single nucleotide polmorphisms within the entire CAT gene and their clinical relevance in patients with noise-induced hearing loss. Int J Clin Exp Patho, 2015; 8, 2852−63.
    [14] Li YH, Yu SF, Gu GZ, et al. Polymorphisms of heat shock protein 70 genes (HSPA1A, HSPA1B and HSPA1L) and susceptibility of noise-induced hearing loss in a Chinese population: A case-control study. Plos One, 2017; 12, e0171722. doi:  10.1371/journal.pone.0171722
    [15] Zhang XH, Ni YQ, Liu Y, et al. Screening of noise-induced hearing loss (NIHL)-associated SNPs and the assessment of its genetic susceptibility. Environ Health-Glob, 2019; 18, 30. doi:  10.1186/s12940-019-0471-9
    [16] Wu YY, Ni JT, Qi MJ, et al. Associations of genetic variation in CASP3 gene with noise-induced hearing loss in a Chinese population: a case-control study. Environ Health-Glob, 2017; 16, 78. doi:  10.1186/s12940-017-0280-y
    [17] Zhao TY, Wang YN, Li Z, et al. Associations of noise kurtosis, genetic variations in NOX3 and lifestyle factors with noise-induced hearing loss. Environ Health-Glob, 2020; 19, 1−13. doi:  10.1186/s12940-019-0557-4
    [18] Henderson D, Bielefeld EC, Harris KC, et al. The role of oxidative stress in noise-induced hearing loss. Ear Hearing, 2006; 27, 1−19. doi:  10.1097/01.aud.0000191942.36672.f3
    [19] Rybak LP, Whitworth CA, Mukherjea D, et al. Mechanisms of cisplatin-induced ototoxicity and prevention. Hearing Res, 2007; 226, 157−67. doi:  10.1016/j.heares.2006.09.015
    [20] Wang XC, Xu PF, Li P, et al. Alterations in gray matter volume due to unilateral hearing loss. Sci Rep, 2016; 6, 25811. doi:  10.1038/srep25811
    [21] Nakajima K, Kanda E, Hosobuchi A, et al. Subclinical hearing loss, longer sleep duration, and cardiometabolic risk factors in Japanese general population. Int J Otolaryngol, 2014; 218.
    [22] Albort-Morant G, Ariza-Montes A, Leal-Rodríguez A, et al. How Does Positive Work-Related Stress Affect the Degree of Innovation Development? Int J Environ Res Public Health, 2020; 17, 520. doi:  10.3390/ijerph17020520
    [23] Qiu W, Davis B, Hamernik RP. Hearing loss from interrupted, intermittent, and time varying Gaussian noise exposures: the applicability of the equal energy hypothesis. J Acoust Soc Am, 2007; 121, 1613−20. doi:  10.1121/1.2434692
    [24] Qiu W, Hamernik RP, Davis RI. The value of a kurtosis metric in estimating the hazard to hearing of complex industrial noise exposures. J Acoust Soc Am, 2013; 133, 2856−66. doi:  10.1121/1.4799813
    [25] Lou XY, Chen GB, Yan L, et al. A generalized combinatorial approach for detecting gene-by-gene and gene-by-environment interactions with application to nicotine dependence. Am J Hum Genet, 2007; 80, 1125−37. doi:  10.1086/518312
    [26] Chen B, Du Z, Dong X, et al. Association of Variant Interactions in RANK, RANKL, OPG, TRAF6, and NFATC1 Genes with the Development of Osteonecrosis of the Femoral Head. DNA Cell Biol, 2019; 38, 734−46. doi:  10.1089/dna.2019.4710
    [27] Feng C, Yang Y, Yang S, et al. Effect of gene-gene and gene-environment interaction on the risk of first-ever stroke and poststroke death. Mol Genet Genomic Med, 2019; 7, e846.
    [28] Zhang LX, Ding RH, Kuang P, et al. Interaction between CONNEXIN37 and PDE4D gene polymorphisms with susceptibility to ischemic stroke in Chinese population. Exp Biol Med, 2019; 244, 1642−7. doi:  10.1177/1535370219885079
    [29] Li J, Wei Z, Hakonarson H. Application of computational methods in genetic study of inflammatory bowel disease. World J Gastroenterol, 2016; 22, 949−60. doi:  10.3748/wjg.v22.i3.949
    [30] Wichmann C, Moser T. Relating structure and function of inner hair cell ribbon synapses. Cell Tissue Res, 2015; 361, 95−114. doi:  10.1007/s00441-014-2102-7
    [31] Moser T, Starr A. Auditory neuropathy - neural and synaptic mechanisms. Nat Rev Neurol, 2016; 12, 135−49.
    [32] Roux I, Safieddine S, Nouvian R, et al. Otoferlin, defective in a human deafness form, is essential for exocytosis at the auditory ribbon synapse. Cell, 2006; 127, 277−89. doi:  10.1016/j.cell.2006.08.040
    [33] Karamoysoyli E, Burnand RC, Tomlinson DR, et al. Neuritin mediates nerve growth factor-induced axonal regeneration and is deficient in experimental diabetic neuropathy. Diabetes, 2008; 57, 181−9. doi:  10.2337/db07-0895
    [34] Fujino T, Leslie JH, Eavri R, et al. CPG15 regulates synapse stability in the developing and adult brain. Genes Dev, 2011; 25, 2674−85. doi:  10.1101/gad.176172.111
    [35] Sharma TP, Liu Y, Wordinger RJ, et al. Neuritin 1 promotes retinal ganglion cell survival and axonal regeneration following optic nerve crush. Cell Death Dis, 2015; 6, e1661. doi:  10.1038/cddis.2015.22
    [36] Zhang P, Luo X, Guo Z, et al. Neuritin Inhibits Notch Signaling through Interacted with Neuralized to Promote the Neurite Growth. Front Mol Neurosci, 2017; 10, 179. doi:  10.3389/fnmol.2017.00179
    [37] Picard N, Leslie JH, Trowbridge SK, et al. Aberrant development and plasticity of excitatory visual cortical networks in the absence of cpg15. J Neurosci, 2014; 34, 3517−22. doi:  10.1523/JNEUROSCI.2955-13.2014
    [38] Xie HW, Qiu W, Heyer NJ, et al. The Use of the Kurtosis-Adjusted Cumulative Noise Exposure Metric in Evaluating the Hearing Loss Risk for Complex Noise. Ear Hearing, 2016; 37, 312−23. doi:  10.1097/AUD.0000000000000251
    [39] Zhang MB, Xie HW, Zhou JN, et al. New Metrics Needed in the Evaluation of Hearing Hazard Associated with Industrial Noise Exposure. Ear Hear, 2020.
    [40] Goley GS, Song WJ, Kim JH. Kurtosis corrected sound pressure level as a noise metric for risk assessment of occupational noises. Journal of the Acoustical Society of America, 2011; 129, 1475−81. doi:  10.1121/1.3533691
    [41] Hwang JH, Chen JC, Hsu CJ, et al. Plasma reactive oxygen species levels are correlated with severity of age-related hearing impairment in humans. Neurobiol Aging, 2012; 33, 1920−6. doi:  10.1016/j.neurobiolaging.2011.10.012
    [42] Fechter LD, Thorne PR, Nuttall AL. Effects of carbon monoxide on cochlear electrophysiology and blood flow. Hear Res, 1987; 27, 37−45. doi:  10.1016/0378-5955(87)90024-4
    [43] Su BM, Chan DK. Prevalence of Hearing Loss in US Children and Adolescents: Findings From NHANES 1988-2010. JAMA Otolaryngol Head Neck Surg, 2017; 143, 920−7. doi:  10.1001/jamaoto.2017.0953
    [44] Han C, Ding D, Lopez MC, et al. Effects of Long-Term Exercise on Age-Related Hearing Loss in Mice. J Neurosci, 2016; 36, 11308−19. doi:  10.1523/JNEUROSCI.2493-16.2016
  • [1] Hongyue Hu, Fangchao Liu, Keyong Huang, Chong Shen, Jian Liao, Jianxin Li, Chenxi Yuan, Ying Li, Xueli Yang, Jichun Chen, Jie Cao, Shufeng Chen, Dongsheng Hu, Jianfeng Huang, Xiangfeng Lu, Dongfeng Gu.  Association between Fish Consumption and Stroke Incidence Across Different Predicted Risk Populations: A Prospective Cohort Study from China . Biomedical and Environmental Sciences, 2025, 38(1): 15-26. doi: 10.3967/bes2025.003
    [2] Qi Ye, Jing Chen, Yating Ji, Xiaoyu Lu, Jiale Deng, Nan Li, Wei Wei, Renjie Hou, Zhiyuan Li, Jianbang Xiang, Xu Gao, Xin Shen, Chongguang Yang.  Independent and Interactive Effects of Air Pollutants, Meteorological Factors, and Green Space on Tuberculosis Incidence in Shanghai . Biomedical and Environmental Sciences, 2025, 38(7): 792-809. doi: 10.3967/bes2025.041
    [3] Xiongfeng Pan, Cailian Wei, Jiayou Luo, Junxia Yan, Xiang Xiao, Jie Wang, Yan Zhong, Miyang Luo.  Exploration of New Susceptible Genes associated with Non-Alcoholic Fatty Liver Disease among Children with Obesity Using Whole Exome Sequencing . Biomedical and Environmental Sciences, 2025, 38(6): 727-739. doi: 10.3967/bes2025.045
    [4] Xiaoqian Jia, Yuan Li, Lei Jin, Lailai Yan, Yali Zhang, Jufen Liu, Le Zhang, Linlin Wang, Aiguo Ren, Zhiwen Li.  Association of Co-Exposure to Polycyclic Aromatic Hydrocarbons and Metal(loid)s with the Risk of Neural Tube Defects: A Case-Control Study in Northern China . Biomedical and Environmental Sciences, 2025, 38(2): 154-166. doi: 10.3967/bes2024.130
    [5] Jie Sun, Junyan Xi, Zhishen Wu, Wangjian Zhang, Jianjun Bai, Yining Xiang, Yucan Zhang, Jiajia Wang, Shihao Wang, Jing Gu, Yuantao Hao, Xiao Lin.  Modifying Effect of Wind Speed on the Temperature-Humidity Interaction Impacting Hand, Foot, and Mouth Disease as Assessed by Years Lived with Disability in Western China . Biomedical and Environmental Sciences, 2025, 39(): 1-12. doi: 10.3967/bes2026.008
    [6] SONG Qin Qin, WANG Yan Hai, WANG Xin Ling, SHI Bing Tian, WANG Rui Fang, SONG Juan, WANG Wen Jun, XIA Dong, XIA Zhi Qiang, WEI Qiang, HAN Jun.  Construction of MicroRNA-Target Interaction Networks Based on MicroRNA Expression Profiles of HRV16-infected H1-HeLa Cells . Biomedical and Environmental Sciences, 2022, 35(9): 854-860. doi: 10.3967/bes2022.109
    [7] ZOU Wen Ying, HU Zhi Yong, XUE Chang Hong, LIU Yun Gang, YE Hua.  Involvement of Stromal Interaction Molecule 1 and Its Downstream Proteins in SiO2 Particle-Induced Release of Inflammatory Mediators from Mouse Macrophage (RAW264.7) Cells . Biomedical and Environmental Sciences, 2022, 35(4): 345-350. doi: 10.3967/bes2022.045
    [8] JIN Nan, ZHONG Hui Yun, YUAN Fang, DENG Hua Xin.  Positive Associations between Bilateral High-Frequency Hearing Loss and Hypertension Risk in Short-Term Occupational Noise Exposure . Biomedical and Environmental Sciences, 2021, 34(12): 992-997. doi: 10.3967/bes2021.134
    [9] WANG Bo Shen, XU Kai, ZHANG Hong, PU Yue Pu, YIN Li Hong, HAN Lei, CHEN Lin, WANG Ning, ZHU Bao Li, ZHANG Juan.  Association between NFE2L2 Gene Polymorphisms and Noise-induced Hearing Loss in a Chinese Population . Biomedical and Environmental Sciences, 2019, 32(6): 465-470. doi: 10.3967/bes2019.063
    [10] KUANG Xiao Dong, YU Xin Bo, CAO Yuan, LI Dong Shui, ZHU Hai Yan.  Interaction between the Circadian Clock and Chronic Stress . Biomedical and Environmental Sciences, 2018, 31(9): 686-699. doi: 10.3967/bes2018.093
    [11] XU Xiang Rong, WANG Jing Jing, YANG Qiu Yue, JIAO Jie, HE Li Hua, YU Shan Fa, GU Gui Zhen, CHEN Guo Shun, ZHOU Wen Hui, WU Hui, LI Yan Hong, ZHANG Huan Ling, ZHANG Zeng Rui, JIN Xian Ning.  The Effect of PCDH15 Gene Variations on the Risk of Noise-induced Hearing Loss in a Chinese Population . Biomedical and Environmental Sciences, 2017, 30(2): 143-146. doi: 10.3967/bes2017.019
    [12] LI Mei Ling, LIN Ji, HOU Jian Guo, XU Lei, CUI Xin Gang, XU Xing Xing, YU Yong Wei, HAN Xue, WANG Guo Min, GUO Jian Ming, XU Dan Feng, THOMPSON Timothy C, CAO Guang Wen, ZHANG Hong Wei.  Environmental and Psycho-social Factors Related to Prostate Cancer Risk in the Chinese Population:a Case-control Study . Biomedical and Environmental Sciences, 2014, 27(9): 707-717. doi: 10.3967/bes2014.089
    [13] WANG Sheng Li, YU Lu Gang, LIU Ren Ping, ZHU Wan Zhan, GAO Wei Min, XUE Li Ping, JIANG Xu.  Gene-Gene Interaction of GJB2, SOD2, and CAT on Occupational Noise-induced Hearing Loss in Chinese Han Population . Biomedical and Environmental Sciences, 2014, 27(12): 965-968. doi: 10.3967/bes2014.131
    [14] YU HongJie, FU ChaoWei, WANG JianMing, XUE HengChuan, XU Biao.  Interaction between XRCC1 Polymorphisms and Intake of Long-Term Stored Rice in the Risk of Esophageal Squamous Cell Carcinoma: A Case-Control Study . Biomedical and Environmental Sciences, 2011, 24(3): 268-274. doi: 10.3967/0895-3988.2011.03.010
    [15] JIA LiHong, SHEN XueLi, FAN Rui, SUN Yan, PAN XingYue, YANH HongMei, LIU Lu.  Risk Factors for Age-Related Macular Degeneration in Elderly Chinese Population in Shenyang of China . Biomedical and Environmental Sciences, 2011, 24(5): 506-511. doi: 10.3967/0895-3988.2011.05.008
    [16] Association of TNF-a-238G/A and 308 G/A Gene Polymorphisms with Pulmonary Tuberculosis among Patients with Coal Worker's Pneumoconiosis . Biomedical and Environmental Sciences, 2010, 23(2): 137-145.
    [17] YUN WANG, XIN LI, WEN-LI ZHU, JIN-ZHEN GUO, XIAO-MING SONG, SHU-QIN LI, YONG LI.  Genome-wide and Interaction Linkage Scan for Nonsyndromic Cleft Lip with or without Cleft Palate in Two Multiplex Families in Shenyang,China . Biomedical and Environmental Sciences, 2010, 23(5): 363-370.
    [18] GUO-HAI CHEN, GUI-XIANG SONG, LI-LI JIANG, YUN-HUI ZHANG, NAI-QING ZHAO, BING-HENG CHEN, HAI-DONG KAN.  Interaction Between Ambient Particles and Ozone and Its Effect on Daily Mortality . Biomedical and Environmental Sciences, 2007, 20(6): 502-505.
    [19] QUN XU, YAN-HUA WANG, WEI-JUN TONG, MING-LIANG GU, GANG WU, BATU BUREN, YONG-YUE LIU, JIAN WANG, YONG-SHAN LI, HUA Feng, SHUANG-LIAN BAI, HAI-HUA PANG, GUI-RONG HUANG, MING-WU FANG, Yong-hong ZHANG, ZHENG-LAI WU, Chang-chun Qiu.  Interaction and Relationship Between Angiotensin Converting Enzyme Gene and Environmental Factors Predisposing to Essential Hypertension in Mongolian Population of China . Biomedical and Environmental Sciences, 2004, 17(2): 177-186.
    [20] Xiao-Xin He, Shui-Gao Jin.  Interaction and Its Solution in Individual Matching Case-control Study . Biomedical and Environmental Sciences, 2003, 16(1): 40-46.
  • 20458.pdf
  • 加载中
图(4) / 表ll (9)
计量
  • 文章访问数:  1598
  • HTML全文浏览量:  726
  • PDF下载量:  121
  • 被引次数: 0
出版历程
  • 收稿日期:  2020-11-10
  • 录用日期:  2021-02-22
  • 网络出版日期:  2021-09-16
  • 刊出日期:  2021-09-20

NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss

doi: 10.3967/bes2021.098
    基金项目:  This work was supported by Zhejiang Key Research and Development Program of China [No.2015C03039; No.20152013A01]; Zhejiang Provincial Program for the Cultivation of High-level Innovative Health Talents, China; Zhejiang Health Innovative Talent Training Project of China, general scientific research project of Zhejiang Science and Technology Department of China [No. Y201941671]; and Natural Science Foundation of Zhejiang Provincial, China [LY18H260002]
    作者简介:

    LIU Shuang Yan, female, born in 1994, Master’s Degree, majoring in occupational noise induced hearing loss

    SONG Wei Qin, female, born in 1992, Master’s Degree, majoring in sensorineural hearing loss

    通讯作者: ZHANG Mei Bian, E-mail: mbzhang@cdc.zj.cnHONG Yu, E-mail: hongyu_xj@126.comYANG Lei, Tel: 86-571-28865010, Fax: 86-571-28865000, E-mail: yanglei62@hznu.edu.cn

English Abstract

LIU Shuang Yan, SONG Wei Qin, XIN Jia Rui, LI Zheng, LEI Song, CHEN Ying Qi, ZHAO Tian Yu, WANG Hai Yan, XU Liang Wen, ZHANG Mei Bian, HONG Yu, YANG Lei. NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss[J]. Biomedical and Environmental Sciences, 2021, 34(9): 705-718. doi: 10.3967/bes2021.098
Citation: LIU Shuang Yan, SONG Wei Qin, XIN Jia Rui, LI Zheng, LEI Song, CHEN Ying Qi, ZHAO Tian Yu, WANG Hai Yan, XU Liang Wen, ZHANG Mei Bian, HONG Yu, YANG Lei. NRN1 and CAT Gene Polymorphisms, Complex Noise, and Lifestyles interactively Affect the Risk of Noise-induced Hearing Loss[J]. Biomedical and Environmental Sciences, 2021, 34(9): 705-718. doi: 10.3967/bes2021.098
    • Noise-induced hearing loss (NIHL) is a slowly progressive sensorineural hearing loss caused by long-term exposure to harmful levels of noise. The World Health Organization (WHO) estimates that approximately 22% of the hearing loss in adults is attributable to occupational and environmental noise exposure, and by 2030, almost 1 billion people will be at the risk of NIHL[1]. As a major occupational health risk, NIHL has become the second-largest occupational disease in China[2]. NIHL is thought to be a complex disease caused by genetic and environmental factors. The main factors include exposure to high levels of noise and individual susceptibility, such as age, gender, education level, smoking frequency, alcohol consumption, and usage practice of hearing protection devices[3-6]. Therefore, the single-locus method may not be appropriate to study common complex disorders such as NIHL.

      Noise is the most common environmental factor leading to occupational hearing loss. The noise exposure metrics used in most previously published studies mainly concentrates on equivalent continuous sound level (Leq) and cumulative noise exposure (CNE). These metrics have been established based on the study of Gaussian noise and the equal-energy hypothesis (EEH), which assumes that the damage to the auditory system caused by noise exposure is proportional to the duration of exposure multiplied by the noise intensity. However, the EEH has been found unsuitable for “complex noise or non-Gaussian (non-G)” noise. Complex noise is ubiquitous in industrial and military environments. It is composed of a transient high-energy impulsive noise superimposed on stationary (Gaussian) background noise[7]. Both animal experiments and epidemiological studies have shown that the EEH underestimates the cochlear impact of complex-noise exposure. The impact of a complex noise on the auditory system was assessed using kurtosis first by Erdreich[8]. This method has simplified the time-domain variables of noise that affect hearing (e.g., pulse peak value, duration, and inter-pulse distribution) into one easy-to-calculate parameter (i.e., kurtosis), which is convenient for classifying the noise type. A high kurtosis indicates that the impulse of the complex noise was high[9]. To date, the efficacy of kurtosis in assessing complex noise has been preliminarily verified in human studies[10,11].

      Increasing evidence has shown the association of susceptibility genes, such as catalase (CAT), heat shock protein70 (HSP70), cadherin-23 (CDH23), caspase (CASP), and NADPH oxidase3 (NOX3), with the development of NIHL[12-18]. Additionally, previous studies have demonstrated that smoking, stressful lifestyle, and physical exercise are associated with hearing loss[19-21]. However, multiple genetic loci may fail to reach genome-wide significance due to the limited power in most genetic studies, and few studies have analyzed the interaction between genetic variants, noise exposure (especially kurtosis), and lifestyle factors on modulating NIHL. Previous studies have never reported multidimensional interactions involving multiple (> 7) genes (especially NRN1 gene) and kurtosis. Therefore, the present study focused on the associations of multi-locus interactions with NIHL risk. In a case-control study with 307 NIHL patients and 307 age- and gender-matched healthy controls, a total of 18 variants (rs1049216, rs6948, rs3805789, rs2227956, rs1043618, rs2763979, rs3749930, rs12665231, rs12195525, rs3752752, rs3802711, rs1227049, rs12415607, rs1127687, rs564250, rs769214, rs769217, and rs7943316) in these 7 susceptibility genes (CAT, HSP70, CDH23, CASP3, CASP7, NOX3, and NRN1), three noise metrics (noise kurtosis, CNE, adj-CNE), and four lifestyle factors (smoking, video volume, physical exercise, working pressure) were included to explore the associations of gene-gene, gene-noise-metric, gene-lifestyle-factor, and noise-metric-lifestyle-factor interactions with the risk of NIHL, and identify the significant interaction model of gene-gene and gene-environment. Our results lay the foundation for a comprehensive prevention program against NIHL.

    • Subjects were continuously recruited between October 2017 and December 2018 from five manufacturing factories with high noise levels in the Zhejiang Province of East China. Inclusion criteria for the subjects were as follows: 1) individuals who had never worked in high noise-level environments from different enterprises, 2) the binaural hearing threshold difference was < 30 dB per frequency; 3) no history of military service; 4) no family history of hearing loss; 5) no history of an ear disease; 6) no history of ototoxic drugs; and 7) no history of diabetes. NIHL was diagnosed based on binaural high-frequency (3,000, 4,000, and 6,000 Hz) average hearing threshold > 25 dB. The subjects were divided into two groups—patients with NIHL and controls with normal hearing—who were matched for gender and age (± 3 years).

    • Sample size was determined using the following formula for the case-control study.

      $${{n}} = \frac{{2{{\bar{{p}}\bar{{q}}}}\;{{\left( {{{{z}}_{{\alpha }}} + {{{z}}_{{\beta }}}} \right)}^2}}}{{{{\left( {{{{p}}_1} - {{{p}}_0}} \right)}^2}}}$$

      α = 0.05, zα = 1.96; β = 0.1, zβ = 1.28; p0 was the minimum allele frequency in the control group, p0 = 0.123 (https://www.ncbi.nlm.nih.gov/snp/); p1 was the minimum allele frequency in the case group, ${{{p}}_1} = \dfrac{{{{{p}}_0}{{OR}}}}{{[1 + {{{p}}_0}({{OR}} - 1)]}} = 0.276$, OR is odds ratio; $\overline {{p}}=\dfrac{{{p}}_{0}+{{p}}_{1}}{2}=0.200$, $ \overline {{q}}=1-\overline {{p}}=0.800 $. A minimum of 143 samples were required for this study based on the above formula. Considering the interactions of gene-gene and gene-environment, a larger sample size was appropriate. In our study, a total of 614 subjects including 307 patients with NIHL and 307 controls with normal hearing were selected, which is sufficient based on the above calculation results for sample size.

    • A questionnaire was designed for each subject based on the needs of the investigation. Collected information included the following: 1) general information (age, sex, etc.); 2) noise exposure factors (factory, work situation, duration of daily noise exposure, etc.); 3) lifestyle factors (smoking, video volume, physical exercise and working pressure). Variables were defined as follows: 1) smoking: smoking one or more cigarettes on average every day, and lasting for at least a year; 2) video volume: The 40% of the maximum volume served as the cutoff point is based on our previous study[17], high video volume is defined as higher than 40% of the maximum volume, and low video volume is defined as lower than 40% of the maximum volume; 3) regular physical exercise: physical exercise on average once a week or more, and lasting for one year or longer; 4) working pressure: a feeling of work-related hardness, frustration, distress, or tension, such as tension, anxiety, and unhappiness[22]. High working pressure is defined as very high and relatively high pressure, and low working pressure is defined as general, relatively low and very low pressure. Participants completed study questionnaires and met with trained investigators in a face-to-face interview. All the participants signed the informed consent form, and the study was approved by the Science Ethics Committee of Hangzhou Normal University (2017LL107).

    • A digital noise dosimeter (ASV5910-R, Hangzhou Aihua Instrument Co., Ltd.) that can operate continuously at a sampling rate of 48 kHz was used to record the noise for each subject for the entire shift duration. Eight-hour, continuous equivalent A-weighted sound levels (LAeq,8h) can be measured with a noise dosimeter, which was attached to the clothing of the participant at the shoulder by clips, with the microphone pointed up (Supplementary Material 1 available in www.besjournal.com). The measurement time was 8 h per shift. A sound level calibrator (Hangzhou Aihua Instrument, AWA6221B) was used to calibrate the noise dosimeter before and after each sampling cycle. MATLAB software (Natick, MA) was used to calculate the sampling kurtosis in a continuous 40-s window of the noise signals during the entire shift. The equation used to calculate kurtosis is shown in Formula 1.

      $$ {{\beta }} = \dfrac{{{{{m}}_4}}}{{{{{m}}_2}}} = \dfrac{{\dfrac{1}{{{n}}}\displaystyle\mathop \sum \nolimits_{{{i}} = 1}^{{n}} {{\left( {{{{x}}_{{i}}} - {\bar{{x}}}} \right)}^4}}}{{{{\left( {\dfrac{1}{{{n}}}\displaystyle\mathop \sum \nolimits_{{{i}} = 1}^{{n}} {{\left( {{{{x}}_{{i}}} - {\bar{{x}}}} \right)}^2}} \right)}^2}}} $$ (1)

      where, ${{{x}}_{{i}}}$ is the ith value, $ \overline {x} $ is the sample mean, and β is noise kurtosis. Theoretically, the kurtosis value of Gaussian noise is 3 (β = 3) and that of complex non-Gaussian noise is greater than 3. The larger the kurtosis value, the higher the impulsiveness of the complex noise. The selection of a 40-s window is acceptable for kurtosis measurement based on a 48-kHz sampling rate, as observed from previous animal data[23, 24]. The median kurtosis calculated in a 40-s window was used as the kurtosis value of the entire shift time. In this study, a median kurtosis of 4 was used as the boundary value between Gaussian and complex non-Gaussian noise.

      Both noise level and noise exposure time should be used to assess NIHL. Therefore, a comprehensive noise exposure metric (CNE) was used to quantify noise energy for each worker according to Formula 2[10]:

      $$ {\rm{CNE}} = {{\rm{L}}_{{\rm{Aeq}},8{\rm{h}}}} + 10{{{\rm{log}}T}} $$ (2)

      where, T is the time of noise exposure in years. CNE is measured in dB (A) per year.

      To incorporate kurtosis (β) into the evaluation of complex noise environments and unify CNE calculations for epidemiologic data, including both Gaussian and complex noise, the kurtosis- adjusted CNE (adj-CNE) was calculated according to Formula 3[10]:

      $${\rm{adj}} - {\rm{CN}}{{\rm{E}}_{{\rm{Kurtosis}} - {\rm{adjusted}}}} = {{\rm{L}}_{{\rm{Aeq}},8{\rm{h}}}} + \frac{{\ln \left( {\rm{\beta }} \right) + 1.9}}{{{\rm{log}}\left( 2 \right)}}{\rm{logT}}$$ (3)

      When Gaussian noise has a kurtosis of β = 3, the term $\left[\dfrac{{{\rm{ln}}\left( {\rm{\beta }} \right) + 1.9}}{{{\rm{log}}\left( 2 \right)}} \right]$ becomes equal to 10. Thus, for Gaussian noise, the adj-CNE equals the unadjusted CNE. Formula (3) shows that when LAeq,8h is fixed, the adj-CNE will be larger for complex noise (β > 3) than that for Gaussian noise (β = 3).

    • Experienced audiologists performed pure-tone audiometry for the left and right ears of each participant at 500, 1,000, 2,000, 3,000, 4,000, 6,000, and 8,000 Hz in a sound-insulated room with background noise < 25 dB (A) (Supplementary Material 2 available in www.besjournal.com). All the subjects were required to be outside of their daily noise environment for at least 16 h before the test. The results of the pure-tone audiometry were adjusted according to gender and age by following the ISO 1999-2013 standard Table A.3. High-frequency NIHL (hNIHL) was diagnosed based on binaural high-frequency hearing threshold levels at 3, 4, and 6 kHz (HTL346) using Formula 4:

      Figure S2.  Interactions of NRN1 rs3805789, CAT rs7943316 and kurtosis associated with NIHL risk identified by GMDR

      $$ {\rm{HT}}{{\rm{L}}_{346}} = \frac{{{\rm{Left}}\left( {{\rm{H}}{{\rm{L}}_{3{\rm{KHz}}}} + {\rm{H}}{{\rm{L}}_{4{\rm{KHz}}}} + {\rm{H}}{{\rm{L}}_{6{\rm{KHz}}}}} \right) + {\rm{Right}}\left( {{\rm{H}}{{\rm{L}}_{3{\rm{KHz}}}} + {\rm{H}}{{\rm{L}}_{4{\rm{KHz}}}} + {\rm{H}}{{\rm{L}}_{6{\rm{KHz}}}}} \right)}}{6}$$ (4)

      A binaural threshold > 25 dB was considered binaural hNIHL[16].

    • Oral mucosa cells from all the participants were collected using Yongming flocking swabs. DNA was extracted using the Tiangen Oral Mucosa Genomic DNA extraction kit (Tiangen Biotech, Beijing, China). For SNP analysis, 18 SNPs were selected from 7 genes (CAT, HSP70, CDH23, CASP3, CASP7, NOX3, and NRN1). The SNP selection process has previously been described[17]. The detailed information about the screened SNPs is shown in Table 1. We performed the genotyping analysis using the Kompetitive allele-specific polymerase chain reaction (KASP) method as previously described[17]. The primer and probe sequences are shown in Supplementary Tables S1 and S2 (available in www.besjournal.com). To control the quality, we randomly selected 10% of the samples and re-classified the genes; the concordance of the 18 SNPs was > 95%.

      Table 1.  Basic information for 18 SNPs

      SNP IDGeneChromosomePositionFunction Alleles
      rs1049216CASP341846289353 Prime UTR VariantG/A
      rs6948CASP341846279763 Prime UTR VariantT/G
      rs3805789NRN166003752Intron Variant, 5 Prime UTR VariantC/T
      rs2227956HSPA1L631810495Missense VariantG/A, C, T
      rs1043618HSPA1A/HSPA1L6318157305 Prime UTR Variant, 2KB Upstream VariantG/A, C, T
      rs2763979HSPA1B6318268152KB Upstream VariantC/T
      rs3749930NOX36155440112Missense VariantG/T
      rs12665231NOX361553954633 Prime UTR VariantT/C
      rs12195525NOX36155454846Stop Gained, Synonymous VariantG/A, T
      rs3752752CDH231071695444Synonymous VariantT/C
      rs3802711CDH231071784329Missense VariantG/A
      rs1227049CDH231071675131Missense VariantG/A, C, T
      rs12415607CASP7101136784452KB Upstream VariantC/A
      rs1127687CASP7101137303503 Prime UTR VariantG/A
      rs564250CAT11344373142KB Upstream VariantT/A, C
      rs769214CAT11344381702KB Upstream VariantG/A
      rs769217CAT1134461361Synonymous VariantC/T
      rs7943316CAT11344389252KB Upstream VariantA/T
        Note. CASP3: Caspase3; NRN1: Neuritin1; HSP: Heat shock protein; NOX3: NADPH Oxidase3; CDH23: Cadherin-23; CASP7: Caspase7; CAT: Catalase.

      Table S1.  Primer information A

      SNP IDPrimer Allele FAMPrimer Allele HEXPrimer Common
      rs1049216AGTAATTGTGAAAAAGTTAAACATTGAAGTAATAGTAATTGTGAAAAAGTTAAACATTGAACCAGTCTTAAGTGGGGGGAATATCATAAAA
      rs6948GGAGGCCAGAGCTGAGCCCGGAGGCCAGAGCTGAGCAAGCCTGCCTCCCGGGCTGA
      rs3805789TTCCGCCCTGAGGCCGACCTTTCCGCCCTGAGGCCGATCACTCAGCTTCCAGCCGGGTT
      rs2227956ATGGTATTCTCAATGTCACAGCCACAATGGTATTCTCAATGTCACAGCCATCTTGTTCACCTTGCCGGTGCTCTT
      rs1043618CCTGCTCTCTGTCGGCTCCCCTGCTCTCTGTCGGCTCGGTGTTCCGTTTCCAGCCCCCAA
      rs2763979ATTCCTGGTTCACTCCTGGACGAATTCCTGGTTCACTCCTGGACACTCGGGACTGTGAGGTCCTACTT
      rs3749930ACACAACCACTGAATTGCTAAGGACAACACAACCACTGAATTGCTAAGGAACAGACCGGTGACGCCTGCTATT
      rs12665231AGCTAAGGAAGTATGGTATAGTGTACTGCTAAGGAAGTATGGTATAGTGTACCCCCAGTTGGGAACTGGTGAATAATAATTA
      rs12195525GTTCCTCTTATGAATGAAATAAGGTTTCAGTTCCTCTTATGAATGAAATAAGGTTTCGCTGTGCCTGAATTTTAACTGCATGCTAAT
      rs3752752AAACATCACCCTCCTGGACATCAATCATCACCCTCCTGGACATCAACGTCCTTCCACGTGGGGTGGTT
      rs3802711GTCCAGCTCCACGTCCTTCCGGTCCAGCTCCACGTCCTTCTTCTCCTGTGGAGGGGGTGCTAA
      rs1227049AGCTGACTTCCCCAAAGGTGGAGCTGACTTCCCCAAAGGTGCGCTGTTGCAGGCAACTGACAATGAT
      rs12415607AATGGAGTACATGCTTAGTGGTCGGAATGGAGTACATGCTTAGTGGTCTAGAAGATGGCGTTCTTGCCTGGTAT
      rs1127687CACTCCATCTCAGTCAGTGGCCTCACTCCATCTCAGTCAGTGGTTGGAAAATGGAGCCATGACAAGAACAAA
      rs564250AGACCTGGAGTCATTTCTTAACCTTTAGACCTGGAGTCATTTCTTAACCTTTGCAAATCCATAGTAACAAAAACAAAGGAAAA
      rs769214TTTCAAAATTCCTGCTTACCTGGGATCAAAATTCCTGCTTACCTGGGGACTGGAGAAATCTGCTTCCCCAAATTTTA
      rs769217GTGGCCAACTACCAGCGTGACAGTGGCCAACTACCAGCGTGATTACCCTGATTGTCCTGCATGCACAT
      rs7943316AAATCTGCCTGTTGCCCCGAGTAAATCTGCCTGTTGCCCCGAGAGGTGCTGATTGGCTGAGCCTGAA

      Table S2.  Primer information B

      SNP IDSequenceCG%_FAMCG%_HEXCG% Common
      rs1049216GGGGAATATCATAAAAATTC[A/G] TTACTTCAATGTTTAACTTT21.224.237.9
      rs6948AGCCTGCCTCCCGGGCTGAG[G/T] GCTCAGCTCTGGCCTCCGGC72.268.473.7
      rs3805789TCTTTCCGCCCTGAGGCCGA[C/T] GAACCCGGCTGGAAGCTGAG7061.961.9
      rs2227956TATTCTCAATGTCACAGCCA[C/T] GGACAAGAGCACCGGCAAGG4438.554.2
      rs1043618CCAGCCCCCAATCTCAGAGC[C/G] GAGCCGACAGAGAGCAGGGA68.468.459.1
      rs2763979GAGGTCCTACTTCTACACAC[C/T] GTCCAGGAGTGAACCAGGAA54.547.856.5
      rs3749930GACCGGTGACGCCTGCTATT[G/T] TCCTTAGCAATTCAGTGGTT4438.559.1
      rs12665231GGAAGTATGGTATAGTGTAC[T/C] GTTCACAATAGTTAATTATT3742.337.9
      rs12195525TATGAATGAAATAAGGTTTC[A/G] ACTGACAGGTATTAGAATTA3032.337.9
      rs3752752ATCACCCTCCTGGACATCAA[T/C] GACAACCACCCCACGTGGAA42.354.561.9
      rs3802711GGAGGGGGTGCTAAGGGTCC[G/A] GAAGGACGTGGAGCTGGACC6561.959.1
      rs1227049GGCAACTGACAATGATGCAG[C/G] CACCTTTGGGGAAGTCAGCT54.554.548
      rs12415607TGGCGTTCTTGCCTGGTATC[C/A] GACCACTAAGCATGTACTCC45.842.348
      rs1127687GGAGCCATGACAAGAACAAA[G/A] CCACTGACTGAGATGGAGTG58.352.239.3
      rs564250GCTTTTTTTTATATAATGAA[C/T] AAAGGTTAAGAAATGACTCC3742.326.7
      rs769214AAAATTCCTGCTTACCTGGG[A/G] GTAAAATTTGGGGAAGCAGA49.24437.9
      rs769217GTGGCCAACTACCAGCGTGA[C/T] GGCCCGATGTGCATGCAGGA61.954.548
      rs7943316GAGCCTGAAGTCGCCACGGA[A/T] CTCGGGGCAACAGGCAGATT54.554.556.5
    • Normally distributed continuous variables are expressed as mean ± standard deviation (SD), and categorical variables are presented as percentages. Student’s t-test and the Chi-square test were used to compare the continuous variables and categorical variables, respectively, between the cases and controls. Non-normally distributed continuous variables were expressed as median (with the lower and upper quartiles) [M (P25, P75)] and analyzed using the Mann-Whitney U test. The cut-off values for the CNE and adj-CNE were determined to be 97.1420 dB(A) and 96.9939 dB(A), respectively, based on the receiver operating characteristic (ROC) curve between CNE, adj-CNE, and NIHL. The Hardy-Weinberg equilibrium (HWE) was tested using the Chi-square test. The generalized multifactor dimensionality reduction (GMDR Software Beta 0.9, www.ssg.uab.edu/gmdr/) method[25] was used to examine the effects of all possible interactions. The sign test of cross-validation consistency (CVC), testing balanced accuracy (TEBA), and trained balanced accuracy (TRBA) were calculated. A multivariate logistic regression model was used for the stratified analysis of the significant interactions obtained from the GMDR. Multiple comparisons were corrected using the Benjamini-Hochberg procedure. P < 0.05 indicated that the differences were statistically significant (shown in bold in the following tables).

    • A total of 614 participants (474 males and 140 females), including 307 NIHL patients and 307 controls, were selected (Table 2). The median age of the subjects was 35 years. 307 patients with NIHL and 307 controls were from packing worker (5.2% and 6.0%, respectively), coating worker (2.1% and 1.0%, respectively), electric welder (3.1% and 2.4%, respectively), fitter (6.8% and 7.0%, respectively), machinist (7.8% and 8.6%, respectively), wire drawing worker (2.3% and 1.8%, respectively), cold heading workers (4.6% and 8.3%, respectively), silk knead worker (3.6% and 4.6%, respectively), grinder (2.0% and 2.4%, respectively), Heat-treater (1.5% and 1.3%, respectively), punching worker (1.6% and 2.3%, respectively), and others (9.5% and 4.2%, respectively). The median kurtosis in the NIHL group was 7.25 (4.63–14.30), which was significantly higher than that in the control group [5.85 (4.06–12.51); P = 0.006]. The proportion of the subjects exposed to complex noise (β ≥ 4) was significantly greater in the NIHL group than that in the control group (P = 0.038). The median HTL346 in the NIHL group was 36.83 (29.83–49.83) dB, which was significantly higher than that in the control group [17.83 (14.17–21.00) dB; P < 0.001). The proportion of the subjects with high CNE (≥ 97.1420), high adj-CNE (≥ 96.9939), smoking habit, propensity to watch videos at high volume, or sedentary lifestyle was significantly greater in the NIHL group than in the control group (P < 0.05). However, there was no significant difference in education level or working pressure between the two groups (P > 0.05).

      Table 2.  General characteristics of subjects between NIHL and control groups

      CharacteristicsTotal (n = 614)NIHL (n = 307)Control (n = 307)χ2/zP
      Sex, n (%)
       Male474 (77.2)237 (38.6)237 (38.6)0.0001.000
       Female140 (22.8)70 (11.4)70 (11.4)
      Age, y35 (30–43)36 (30–43)34 (30–42)−1.9590.050
      Education, n (%)
       High school and above347 (56.5)168 (27.4)179 (29.2)0.8020.371
       Junior high school and below267 (43.5)139 (22.6)128 (20.8)
      Type of work, n (%)
      Packing worker/
      Coating worker/
      Electric welder
      69 (11.2)/
      19 (3.1)/ 34 (5.5)
      32 (5.2)/
      13 (2.1)/19 (3.1)
      37 (6.0)/
      6 (1.0)/15 (2.4)
      __
       Fitter/Machinist85 (13.8)/101 (16.4)42 (6.8)/48 (7.8)43 (7.0)/53 (8.6)
      Wire drawing worker/
      Cold heading workers/
      Silk knead worker
      25 (4.1)/
      79 (12.9)/50 (8.2)
      14 (2.3)/
      28 (4.6)/22 (3.6)
      11 (1.8)/
      51 (8.3)/28 (4.6)
      Grinder/Heat-treater/
      Punching worker
      27(4.4)/
      17 (2.8)/24 (3.9)
      12 (2.0)/
      9 (1.5)/10 (1.6)
      15 (2.4)/
      8 (1.3)/14 (2.3)
       Others84 (13.7)58 (9.5)26 (4.2)
      Years of noise exposure, y3.00
      (1.43–6.00)
      3.00
      (1.20–6.00)
      3.00
      (2.00–6.00)
      −1.0020.317
      HTL346, dB25.00
      (17.83–36.96)
      36.83
      (29.83–49.83)
      17.83
      (14.17–21.00)
      −21.442< 0.001
      Kurtosis, median (P25–P75)6.62
      (4.28–13.15)
      7.25
      (4.63–14.30)
      5.85
      (4.06–12.51)
      −2.7550.006
       < 4114 (18.6)47 (7.7)67 (10.9)4.0390.038
       ≥ 4500 (81.4)260 (42.3)240 (39.1)
      CNE, median (P25–P75), dB(A)93.69
      (89.48–97.57)
      93.73
      (89.67–98.24)
      93.62
      (89.07–96.88)
      −1.230.219
       < 97.1420449 (73.1)213 (34.7)236 (38.4)4.3840.036
       ≥ 97.1420165 (26.9)94 (15.3)71 (11.6)
      Adj-CNE, median (P25–P75), dB(A)94.89
      (90.02–99.23)
      95.34
      (90.20–99.61)
      94.61
      (89.75–98.59)
      −1.5640.118
       < 96.9939387 (63.0)178 (29.0)209 (34.0)6.7170.010
       ≥ 96.9939227 (37.0)129 (21.0)98 (16.0)
      Smoking, n (%)
       No325 (52.9)150 (24.4)175 (28.5)4.0860.043
       Yes289 (47.1)157 (25.6)132 (21.5)
      Video volume, n (%)
       Low149 (24.3)60 (9.8)89 (14.5)7.4530.006
       High465 (75.7)247 (40.2)218 (35.5)
      Physical exercise, n (%)
       Never418 (68.1)224 (36.5)194 (31.6)6.7450.009
       Regular196 (31.9)83 (13.5)113 (18.4)
      Working pressure, n (%)
       Low113 (18.4)49 (8.0)64 (10.4)2.4400.118
       High501 (81.6)258 (42.0)243 (39.6)
    • The genotype frequencies among the cases and controls did not deviate from the HWE for any of the 18 SNPs (P > 0.05, Table 3). We assessed for NIHL-related interactions among the 18 genetic variants by using GMDR. Consequently, 18 models were generated from the 18 SNPs (Table 4). After adjusting age, gender, education level, years of noise exposure, kurtosis, CNE, adj-CNE, smoking, video volume, physical exercise, and working pressure, a significant two-locus model (P = 0.0107) involving NRN1 rs3805789 and CAT rs7943316 was found (Table 4, Supplementary Figure S1 available in www.besjournal.com). The CVC of this two-locus model was 10/10, and the TEBA was 0.5768. We then conducted a stratified analysis for the significant models by using logistic regression. When compared with the subjects carrying NRN1 rs3805789-CC and CAT rs7943316-AA, those with NRN1 rs3805789-CC and CAT rs7943316-AT, NRN1 rs3805789-CT and CAT rs7943316-AA, NRN1 rs3805789-CT and CAT rs7943316-TT, NRN1 rs3805789-CT/TT and CAT rs7943316-AA, or NRN1 rs3805789-CC and CAT rs7943316-AT/TT had higher risks of NIHL (OR: 2.276, 95% CI: 1.171–4.427; OR: 2.213, 95% CI: 1.273–3.849; OR: 3.169, 95% CI: 1.425–7.048; OR: 2.005, 95% CI: 1.200–3.348; OR: 1.892, 95% CI: 1.008–3.550; P < 0.05) (Figure 1, Supplementary Table S3 available in www.besjournal.com).

      Table 3.  The genotype and allele frequencies of 18 SNPs in NIHL cases and control subjects

      SNP IDGeneGroupGenotype (frequency %)Allele (frequency %)POR (95% CI)MAFaMAFbHWE P
      rs1049216CASP3AAAGGGAG
      Case10 (3.3)105 (34.2)192 (62.5)125 (20.4)489 (79.6)0.0461.046
      (1.005–1.802)
      0.4030.1600.616
      Control9 (2.9)80 (26.1)218 (71.0)98 (16.0)516 (84.0)
      rs6948CASP3GGGTTTGT
      Case10 (3.3)92 (30.0)205 (66.8)112 (18.2)502 (81.8)0.0641.334
      (0.982–1.809)
      0.4260.1430.431
      Control8 (2.6)72 (23.5)227 (73.9)88 (14.3)526 (85.7)
      rs3805789NRN1CCCTTTCT
      Case84 (27.4)163 (53.1)60 (19.5)331 (53.9)283 (46.1)0.8641.020
      (0.815–1.276)
      0.3000.4660.216
      Control93 (30.3)142 (46.3)72 (23.5)328 (53.4)286 (46.6)
      rs2227956HSPA1LCCCTTTCT
      Case15 (4.9)86 (28.0)206 (67.1)116 (18.9)498 (81.1)0.9420.989
      (0.744–1.316)
      0.1230.1910.671
      Control10 (3.3)97 (31.6)200 (65.1)117 (19.1)497 (80.9)
      rs1043618HSPA1A/
      HSPA1L
      CCCGGGCG
      Case42 (13.7)118 (38.4)147 (47.9)202 (32.9)412 (67.1)0.9030.985
      (0.777–1.250)
      0.4810.3320.587
      Control36 (11.7)132 (43.0)139 (45.3)204 (33.2)410 (66.8)
      rs2763979HSPA1BCCCTTTCT
      Case168 (54.7)102 (33.2)37 (12.1)438 (71.3)176 (28.7)0.4531.098
      (0.860–1.403)
      0.4480.3060.387
      Control151 (49.2)124 (40.4)32 (10.4)426 (69.4)188 (30.6)
      rs3749930NOX3GGGTTTGT
      Case86 (28.0)148 (48.2)73 (23.8)320 (52.1)294 (47.9)0.1231.192
      (0.953–1.492)
      0.1970.4770.662
      Control68 (22.1)157 (51.1)82 (26.7)293 (47.7)321 (52.3)
      rs12665231NOX3CCCTTTCT
      Case23 (7.5)100 (32.6)184 (59.9)146 (23.8)468 (76.2)0.8410.974
      (0.749–1.265)
      0.1880.2430.126
      Control23 (7.5)103 (33.6)181 (59.0)149 (24.3)465 (75.7)
      rs12195525NOX3GGTGTTGT
      Case267 (87.0)35 (11.4)5 (1.6)569 (92.7)45 (7.3)0.0571.471
      (0.987–2.193)
      0.1290.1040.103
      Control249 (81.1)52 (16.9)6 (2.0)550 (89.6)64 (10.4)
      rs3752752CDH23CCTCTTCT
      Case84 (27.4)142 (46.3)81 (26.4)310 (50.5)304 (49.5)0.9540.994
      (0.794–1.243)
      0.4450.4930.154
      Control85 (27.7)141 (45.9)81 (26.4)311 (50.7)303 (49.3)
      rs3802711CDH23AACACCAC
      Case19 (6.2)107 (34.9)181 (59.0)145 (23.6)469 (76.4)0.3051.151
      (0.880–1.506)
      0.1390.2120.345
      Control11 (3.6)108 (35.2)188 (61.2)130 (21.2)484 (78.8)
      rs1227049CDH23CCCGGGCG
      Case37 (12.1)127 (41.4)143 (46.6)201 (32.7)413 (67.3)0.3251.129
      (0.887–1.436)
      0.1850.3010.612
      Control26 (8.5)133 (43.3)148 (48.2)185 (30.1)429 (69.9)
      rs12415607CASP7AACACCAC
      Case51 (16.6)155 (50.5)101 (32.9)257 (41.90357 (58.1)0.0351.280
      (1.017–1.611)
      0.2680.3600.237
      Control35 (11.4)151 (49.2)121 (39.4)221 (36.0)393 (64.0)
      rs1127687CASP7AAGAGGAG
      Case17 (5.5)94 (30.6)196 (63.8)128 (20.8)486 (79.2)0.1030.801
      (0.613–1.046)
      0.2300.2480.955
      Control19 (5.5)114 (37.1)174 (56.7)152 (24.8)462 (75.2)
      rs564250CATCCTCTTCT
      Case195 (63.5)92 (30.0)20 (6.5)482 (78.5)132 (21.5)0.6230.933
      (0.709–1.229)
      0.2120.2040.249
      Control198 (64.5)93 (30.3)16 (5.2)489 (79.6)125 (20.4)
      rs769214CATAAAGGGAG
      Case31 (10.1)120 (39.1)156 (50.8)182 (29.6)432 (70.4)0.8520.977
      (0.765–1.247)
      0.4730.3010.972
      Control28 (9.1)129 (42.0)150 (48.9)185 (30.1)429 (69.9)
      rs769217CATCCCTTTCT
      Case83 (27.0)148 (48.2)76 (24.8)314 (51.1)300 (48.9)0.8641.020
      (0.815–1.275)
      0.2630.4930.333
      Control83 (27.0)145 (47.2)79 (25.7)311 (50.7)303 (49.3)
      rs7943316CATAAATTTAT
      Case160 (52.1)112 (36.5)35 (11.4)432 (70.4)182 (29.6)0.6641.056
      (0.827–1.347)
      0.4880.3080.609
      Control149 (48.5)127 (41.4)31 (10.1)425 (69.2)189 (30.8)
        Note. MAF: Minor allele frequency; HWE: Hardy–Weinberg equilibrium; a1000 genomes; bData form this study; OR: odds ratio; CI: confidence interval. P-values of deviation from HWE between the NIHL group and control group.

      Table 4.  Association of multidimensional gene-gene interactions of 18 SNPs with NIHL risk

      No. of lociModelTRBATEBAP valueCVC
      1X10.54800.51127 (0.1719)8/10
      2X3 X180.59210.57719 (0.0107)10/10
      3X3 X10 X160.61860.51166 (0.3770)3/10
      4X3 X8 X10 X180.66620.45912 (0.9893)2/10
      5X3 X6 X10 X13 X170.73920.46504 (0.8281)3/10
      6X3 X5 X10 X12 X13 X170.82900.52187 (0.1719)8/10
      7X3 X5 X7 X10 X11 X12 X170.90600.55386 (0.3770)9/10
      8X3 X5 X7 X10 X11 X12 X13 X170.95270.43512 (0.9893)4/10
      9X3 X4 X5 X7 X8 X10 X12 X13 X170.9927NaN4 (0.8281)4/10
      10X3 X4 X5 X7 X8 X10 X11 X12 X13 X170.9926NaN4 (0.8281)3/10
      11X2 X3 X4 X5 X6 X7 X8 X11 X12 X14 X170.9981NaN3 (0.9453)1/10
      12X1 X3 X4 X5 X6 X7 X8 X10 X12 X13 X14 X171.0000NaN2 (0.9893)1/10
      13X1 X2 X3 X4 X5 X7 X8 X9 X11 X12 X14 X16 X171.0000NaN3 (0.9453)2/10
      14X1 X2 X3 X4 X5 X6 X7 X8 X9 X11 X12 X14 X16 X171.0000NaN4 (0.8281)4/10
      15X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X181.0000NaN2 (0.9893)8/10
      16X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X15 X181.0000NaN0 (1.0000)8/10
      17X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X15 X16 X171.0000N/A0 (1.0000)10/10
      18X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 X13 X14 X15 X16 X17 X181.0000N/A0 (1.0000)10/10
        Note. P-values were obtained from the GMDR analysis which adjusted for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE, smoking, video volume, physical exercise, and working pressure. TRBA: Training balanced accuracy; TEBA: Testing Balanced accuracy; CVC: cross-validation consistency; X1: CASP3 rs1049216; X2: CASP3 rs6948; X3: NRN1 rs3805789; X4: HSPA1L rs2227956; X5: HSPA1A/HSPA1L rs1043618; X6: HSPA1B rs2763979; X7: NOX3 rs3749930; X8: NOX3 rs12665231; X9: NOX3 rs12195525; X10: CDH23 rs3752752; X11: CDH23 rs3802711; X12: CDH23 rs1227049; X13: CASP7 rs12415607; X14: CASP7 rs1127687; X15: CAT rs564250; X16: CAT rs769214; X17: CAT rs769217; X18: CAT rs7943316.

      Figure S1.  Interactions of NRN1 rs3805789 and CAT rs7943316 associated with NIHL risk identified by GMDR

      Figure 1.  Stratified analysis for gene–gene interaction on NIHL risk using logistic regression.

      Table S3.  Jointed effects of NRN1 and CAT on NIHL by using the logistic regression models

      NRN1CATRisk of NIHL
      rs3805789rs7943316Controls/Cases, n (%)ORs (95% CI)*PFDR
      CCAA55 (17.9)/39 (12.7)1.00
      CCAT29 (9.4)/41 (13.4)2.276 (1.171–4.427)0.0150.041
      CCTT9 (2.9)/4 (1.3)0.650 (0.173–2.442)0.5240.64
      CTAA61 (19.9)/87 (28.3)2.213 (1.273–3.849)0.0050.028
      CTAT67 (21.8)/48 (15.6)1.036 (0.578–1.857)0.9050.905
      CTTT14(4.6)/28 (9.1)3.169 (1.425–7.048)0.0050.028
      TTAA33 (10.7)/34 (11.1)1.620 (0.419–6.205)0.1540.282
      TTAT31(10.1)/23 (7.5)1.048 (0.514–2.137)0.8980.905
      TTTT8 (2.6)/3 (1.0)0.558 (0.131–2.377)0.4300.591
      CT+TTAA94 (30.6)/121 (39.4)2.005 (1.200–3.348)0.0080.029
      CCAT+TT38 (12.4)/45 (14.7)1.892 (1.008–3.550)0.0470.103
      CT+TTAT+TT120 (39.1)/102 (33.2)1.255 (0.752–2.094)0.3850.591
        Note. NRN1: neuritin 1; CAT: catalase; ORs: odds ratio; CI: confidential interval. *ORs (95% CI) and P value were obtained with the use of multivariate logistic regression analysis after adjustment for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE, smoking, video volume, physical exercise, and working pressure. FDR (false discovery rate) was obtained with the use of Benjamin-Hochberg procedure for controlling the false positive rate in multiple comparison.
    • We next asked whether there were any multidimensional interactions between the genes and noise metrics by using the GMDR method. After adjustments were made for age, gender, education, smoking, video volume, physical exercise, and working pressure, the best model for the risk of NIHL was found to be the interaction between NRN1 rs3805789, CAT rs7943316, and kurtosis. This interaction had the score of 10/10 for CVC and 10 for the sign test (P = 0.0010; Table 5A, Supplementary Figure S2 available in www.besjournal.com). The joint effects of the individual interactions of NRN1 rs3805789 and CAT rs7943316 with kurtosis on NIHL risk were analyzed via logistic regression analysis. The results showed that, after adjusting age, gender, education level, years of noise exposure, smoking, video volume, physical exercise, and working pressure, the subjects exposed to complex noise who carried NRN1 rs3805789-CT and CAT rs7943316-TT or NRN1 rs3805789-CT/TT and CAT rs7943316-AA had higher risks of NIHL than those exposed to steady noise who carried NRN1 rs3805789-CC and CAT rs7943316-AA (OR: 5.961, 95% CI: 1.219–29.155; OR: 1.607, 95% CI: 1.035–2.494; P < 0.05) (Figure 2, Supplementary Table S4 available in www.besjournal.com). In the GMDR model, a two-locus model including NRN1 rs3805789 and CAT rs7943316 was found to be significant. This observation is consistent with the results of gene-gene interactions. A four‐locus model including NRN1 rs3805789, CAT rs7943316, kurtosis, and adj-CNE was found to be the interaction, in which the CVC was 10/10, and the TEBA was 0.5856 (P = 0.0107; Table 5A). In addition, a five‐locus model was also identified for the risk of NIHL. In this model, the CVC was 10/10, and TEBA was 0.5856 (P = 0.0107; Table 5A).

      Table 5.  Associations of interactions among genes, noise metrics and lifestyle factors with the risk of NIHL

      No. of lociModelTRBATEBAP valueCVC
      A. Gene–noise-metric interactiona
      1K40.53630.49075 (0.6230)4/10
      2X3 X180.59030.57629 (0.0107)10/10
      3X3 X18 K40.60030.586310 (0.0010)10/10
      4X3 X18 adj-CNE K40.61250.58569 (0.0107)10/10
      5X3 X18 adj-CNE CNE K40.61250.58569 (0.0107)10/10
      B. Gene–lifestyle-factor interactionb
      1Y30.55540.53566 (0.3770)9/10
      2X3 X180.59270.53497 (0.1719)7/10
      3X3 X18 Y40.62910.53779 (0.0107)5/10
      4X3 X18 Y1 Y30.68300.58509 (0.0107)9/10
      5X3 X18 Y1 Y3 Y40.73870.55709 (0.0107)7/10
      6X3 X18 Y1 Y2 Y3 Y40.79460.58669 (0.0010)10/10
      C. Noise-metric–lifestyle-factor interactionc
      1Y30.55430.53406 (0.3770)9/10
      2Y2 Y30.58160.52097 (0.1719)5/10
      3Y2 Y3 Y40.60690.47923 (0.9453)6/10
      4Y1 Y2 Y3 Y40.64940.55099 (0.0107)10/10
      5Y1 Y2 Y3 Y4 K40.67780.54679 (0.0107)10/10
      6Y1 Y2 Y3 Y4 K4 adj-CNE0.69700.54379 (0.0107)7/10
      7Y1 Y2 Y3 Y4 K4 adj-CNE CNE0.69200.55039 (0.0107)10/10
        Note. aAdjusted for age, gender, education, smoking, video volume, physical exercise, and working pressure; bAdjusted for age, gender, education, years of exposure, kurtosis, CNE, adj-CNE; cAdjusted for age, gender, education; TRBA: Training balanced accuracy; TEBA: Testing Balanced accuracy; CVC: cross-validation consistency; X3: NRN1 rs3805789; X18: CAT rs7943316; K4: kurtosis; Y1: smoking; Y2: video volume; Y3: physical exercise; Y4: working pressure.

      Figure 2.  Joint effects of the NRN1 rs3805789 and CAT rs7943316 with kurtosis on NIHL risk. The reference group was defined as subjects exposed steady-state noise who carry NRN1 rs3805789 CC and CAT rs7943316 AA. Ref: reference group. The odds ratios (ORs) were calculated by the logistic regression analysis after adjustment for age, gender, education, years of exposure, smoking, video volume, physical exercise, and working pressure.

      Table S4.  Jointed effects on NIHL between high-risk genotypes of NRN1and CAT and kurtosis

      Combination of kurtosis and genotypes of NRN1and CATControls/Cases, n (%)ORs (95% CI)*P*FDR
      Steady-state noisers3805789 CC-rs7943316 AA9 (2.9)/8 (2.6)1.000
      rs3805789 CC-rs7943316 AT6 (2.0)/9 (2.9)2.499 (0.561–11.133)0.2300.814
      rs3805789 CC-rs7943316 TT3 (1.0)/0 (0.0)0.0000.9991.000
      rs3805789 CT-rs7943316 AA19 (6.2)/14 (14.6)1.317 (0.375–4.626)0.6671.078
      rs3805789 CT-rs7943316 AT15 (4.9)/7 (2.3)0.817 (0.206–3.234)0.7730.895
      rs3805789 CT-rs7943316 TT3 (1.0)/2 (0.7)0.992 (0.122–8.078)0.9941.047
      rs3805789 TT-rs7943316 AA7 (2.3)/5 (1.6)1.289 (0.269–6.185)0.7510.987
      rs3805789 TT-rs7943316 AT4 (1.3)/2 (0.7)0.734 (0.098–5.485)0.7630.941
      rs3805789 TT-rs7943316 TT1 (0.3)/0 (0.0)0.0001.0001.000
      rs3805789 CT/TT-rs7943316 AA26 (8.5)/19 (6.2)1.273 (0.388–4.179)0.6911.013
      rs3805789 CC-rs7943316 (AT+TT)9 (2.9)/9 (2.9)1.723 (0.422–7.040)0.4491.041
      rs3805789 (CT+TT)-rs7943316 (AT+TT)23 (7.5)/11 (3.6)0.772 (0.220–2.710)0.6861.013
      Complex noisers3805789 CC-rs7943316 AA46 (15.0)/31 (10.1)1.540 (0.348–6.809)0.5691.043
      rs3805789 CC-rs7943316 AT23 (7.5)/32 (10.4)3.347 (0.740–15.139)0.1170.644
      rs3805789 CC-rs7943316 TT6 (2.0)/4 (1.3)1.336 (0.193–9.262)0.7700.895
      rs3805789 CT-rs7943316 AA42 (13.7)/73 (23.8)3.875 (0.895–16.774)0.0700.051
      rs3805789 CT-rs7943316 AT52 (16.9)/41 (13.4)1.689 (0.391–7.288)0.4830.966
      rs3805789 CT-rs7943316 TT11 (3.6)/26 (8.5)5.961(1.219–29.155)0.0280.374
      rs3805789 TT-rs7943316 AA26 (8.5)/29 (9.4)2.625 (0.581–11.864)0.2100.843
      rs3805789 TT-rs7943316 AT27 (8.8)/21 (6.8)1.750 (0.380–8.057)0.4730.966
      rs3805789 CT+TT-rs7943316 AA68 (22.1)/102 (33.2)1.607 (1.035–2.494)0.0340.051
      rs3805789 CC-rs7943316 (AT+TT)23 (9.4)/36 (11.7)1.378 (0.761–2.495)0.2900.800
      rs3805789 (CT+TT)-rs7943316 (AT+TT)97 (31.6)/91 (29.6)0.945 (0.411–1.270)0.2590.800
        Note. *ORs (95% CI) and P value were obtained with multivariate logistic regression analysis after adjustment for age, gender, education, years of exposure, smoking, video volume, physical exercise, and working pressure. FDR (false discovery rate) was obtained from the Benjamin-Hochberg procedure.
    • The GMDR model was used to screen for the best gene-lifestyle-factor combinations. After adjusting age, gender, education level, years of noise exposure, kurtosis, CNE, and adj-CNE, the best six-locus model involving NRN1 rs3805789, CAT rs7943316, smoking, video volume, physical exercise, and working pressure for the risk of NIHL was found to be the interaction, which scored 10/10 for CVC and 9 for the sign test (P = 0.0010; Table 5B). A four‐locus model involving NRN1 rs3805789, CAT rs7943316, smoking, and physical exercise was found to be the interaction, which scored 9/10 for CVC and 9 for sign test (P = 0.0107; Table 5B). A three‐locus model involving NRN1 rs3805789, CAT rs7943316, and working pressure was found to be the interaction, which scored 5/10 for CVC and 9 for the sign test (P = 0.0107; Table 5B). Moreover, a five‐locus model was also identified for the risk of NIHL. The corresponding CVC and TEBA were 7/10 and 0.5570, respectively (P = 0.0107; Table 5B).

    • We next evaluated the interaction combinations between noise metrics and lifestyle factors via the GMDR model. The results revealed that, after adjusting age, gender, and education level, a five-locus model involving smoking habit, video volume, physical exercise, working pressure, and kurtosis was found to be the interaction, which scored 10/10 for CVC and 9 for the sign test (P = 0.0107; Table 5C). A four-locus model involving smoking, video volume, physical exercise, and working pressure was found to be the interaction (P = 0.0107; Table 5C), in which the CVC was 10/10, and the TEBA was 0.5509. A seven‐locus model involving smoking, video volume, physical exercise, working pressure, kurtosis, CNE, and adj-CNE was found to be the interaction, which scored 10/10 for CVC and 9 for the sign test (P = 0.0107; Table 5C). Furthermore, a six‐locus model was also identified for the risk of NIHL. The corresponding CVC and TEBA were 7/10 and 0.5437, respectively (P = 0.0107; Table 5C).

    • In the current study, the association between gene polymorphisms, noise metrics, lifestyle factors, and NIHL was preliminarily explored using univariate analysis. The GMDR method was used to detect the association of the interaction among multiple factors with the risk of NIHL. The GMDR method explores interactions by collapsing the high-dimensional interactions of multiple factors into a single dimension. This method not only avoids biases associated with disease risk by adjusting confounding covariates, but also explores complex multi-locus interactions between genetic and environmental factors. Over the past ten years, the GMDR method has been widely applied to analyze the associations of gene–gene and gene–environment interactions with many complex diseases[26-28].

    • Increasing evidence has shown that multiple genes are closely associated with susceptibility to NIHL. Given that multiple genetic loci with moderate effects fail to reach genome-wide significance due to the limited power in most genetic studies[29], the present study focused on the associations of multi-locus interactions with NIHL risk by analyzing 18 variants in 7 susceptibility genes via the GMDR method. These genes were CAT, HSP70, CDH23, CASP3, CASP7, NOX3, and NRN1. These risk genes play significant roles in apoptosis, cell adhesion, and oxidative stress during the development of NIHL. We identified for the first time that the interaction between NRN1 rs3805789 and CAT rs7943316 increased susceptibility to NIHL. We further validated this genetic interaction via stratified analysis. The results illustrated that subjects carrying NRN1 rs3805789-CC and CAT rs7943316-AT, NRN1 rs3805789-CT and CAT rs7943316-AA, NRN1 rs3805789-CT and CAT rs7943316-TT, NRN1 rs3805789-CT/TT and CAT rs7943316-AA, or NRN1 rs3805789-CC and CAT rs7943316-AT/TT had higher risks of NIHL than those with NRN1 rs3805789-CC and CAT rs7943316-AA. Yang et al.[13] found that CAT rs208679 and rs769217 were significantly associated with the risk of NIHL. A study by Wang et al.[12] have studied the association of CAT rs7943316 with NIHL susceptibility. Their results indicated that carriers of T allele (AT+TT) of rs7943316 have significantly higher risks of NIHL than those with AA genotype (P < 0.05), and observed that a significant interaction model involving GJB2 rs4880, SOD2 rs137852540, and CAT rs769214 might associated with NIHL. These results are similar to our results presented here. CAT is an oxidative-stress gene. Its mutation weakens the anti-oxidant system in the cochlea, thereby hampering the elimination of the reactive oxygen species generated by noise exposure. Consequently, the structure and function of the cochlea are impaired, ultimately causing hearing loss. Furthermore, noise exposure can damage cochlear hair cells and ribbon synapses between hair cells and nerve fibres[30-32]. NRN1 is a small polypeptide closely related to the plasticity of neurites in the human central nervous system. As a neurotrophic factor, NRN1 has multiple effects in the nervous system. It can significantly promote the growth and branch formation of neurites[33] and establishment of functional synapses[34]. Additionally, it is necessary for the survival of neurons[35]. A previous study by our group has shown that a recombinant NRN1 induced extensive neuritogenesis from PC12 cells[36]. Picard et al. have observed that knocking out NRN1 impairs the development and plasticity of excitatory visual cortical networks in mice[37]. Taken together, these studies reveal that NRN1 may play an important role in NIHL by promoting neurodevelopment and neural plasticity.

    • Complex noise is ubiquitous in industrial environments. Complex noise with impact and impulse damages the auditory system more than steady-state noise at the equivalent level[10, 11, 38]. Previous studies on noise have considered only the effect of noise energy on the auditory system, ignored the effect of noise temporal structure, and underestimated the degree of hearing loss associated with complex noise[39]. In this study, we focused on noise kurtosis. This factor was used to describe the characteristics of impulsive noise, distinguish between steady-state and complex noises, and assess the effect of complex noise on hearing loss. We found that the NIHL group had a higher median noise kurtosis and a larger proportion of workers exposed to complex noise than the control group, consistent with our previous report[17]. In a previous study, mean kurtosis was used to describe the temporal structure of noise, and a mean kurtosis of 10 was used as the boundary value between Gaussian and complex noises. In our study presented here, the median kurtosis of 4 was considered as the boundary. Noise damages the auditory system via direct mechanical force and by disrupting the metabolism[10]. Considering that complex noise is more harmful to the auditory system than steady-state noise, researchers have begun to adjust the energy parameters or exposure time by using kurtosis. For example, Zhao et al.[10] and Goley et al.[40] have proposed correction methods for exposure time and noise energy, respectively. In this study, the correction method for the exposure time was used to adjust the CNE. We observed an association between CNE, adj-CNE, and NIHL through univariate analysis. The multidimensional interactions between genes and noise metrics were analyzed using the GMDR method. The best model for the risk of NIHL was found to be the interaction among NRN1 rs3805789, CAT rs7943316, and kurtosis. To date, studies have never reported the associations of such interactions with the risk of NIHL. The further stratified analysis revealed that the subjects exposed to complex noise who carried NRN1 rs3805789-CT and CAT rs7943316-TT or NRN1 rs3805789-CT/TT and CAT rs7943316-AA were at a higher risk of NIHL than those exposed to steady noise who carried both NRN1 rs3805789-CC and CAT rs7943316-AA. This observation illustrates that complex-noise exposure increases the effect of the interaction between NRN1 rs3805789 and CAT rs7943316 on NIHL risk. In addition, interaction among NRN1 rs3805789, CAT rs7943316, kurtosis, CNE, and adj-CNE was also identified as a risk factor for NIHL. This result indicates that kurtosis, CNE, and adj-CNE may affect the development of NIHL not only through direct effects but also through interactions with genes.

    • The risk of NIHL was also affected by lifestyle factors. In this study, we found a significant difference in smoking, video volume, and physical exercise between the two groups. We further investigated gene-lifestyle-factor interactions while investigating the effects of noise-metric-lifestyle-factor interactions on NIHL. We observed a cross-reaction involving NRN1 rs3805789, CAT rs7943316, smoking, video volume, physical exercise, and working pressure for the risk of NIHL. Furthermore, we also found a potential five‐locus noise-metric–lifestyle-factor interaction model involving smoking, video volume, physical exercise, working pressure, and kurtosis, as well as a seven‐locus model including smoking, video volume, physical exercise, working pressure, kurtosis, CNE, and adj-CNE. These results are similar to the previous results of our group[17]. Previous results showed that there were positive interactions between noise kurtosis with smoking, video volume and physical exercise. However, previous studies analyzed only the interactions between two-category variables via crossover analysis and failed to analyze the effects of CNE and adj-CNE on the risk of NIHL. Many studies have shown that smoking-induced hearing loss is likely due to vascular changes, including capillary contraction, increased blood viscosity, and cochlear anoxia[41, 42]. High-level noise exposure may lead to hearing loss via a mechanism involving reduced cochlear oxygen tension during and after noise exposure[43]. Moreover, lack of exercise affects blood, oxygen, and nutrient flow to the cochlea, leading to the degradation of the stria vascularis (SV). Blood vessels in the SV are essential for transporting necessary factors, such as oxygen and glucose, to the cochlea[44].

    • This study is superior to previous studies in multiple aspects. First, we firstly focused on the effects of multidimensional interactions on NIHL risk by analyzing 18 variants, three noise metrics, and four lifestyle factors. Second, we identified for the first time that interaction between NRN1 rs3805789 and CAT rs7943316 increases NIHL susceptibility. Third, the associations of the interactions among NRN1 rs3805789, CAT rs7943316, and kurtosis with the risk of NIHL was detected for the first time. However, this study had some limitations as well. First, we could not obtain data regarding other important confounding factors, such as hypertension and diabetes, due to technical reasons. Second, the analyses of lifestyle factors depended on the recollection of the subjects, which can be unreliable. Third, because the sample size is not large enough, the results obtained from this study should be verified by studies involving larger sample sizes. Finally, this study is an association study, the mechanisms of the gene-gene or gene–environmental-factor interactions should be investigated in future laboratory and clinical studies.

    • In conclusion, complex noise, high CNE, high adj-CNE, smoking, high video volume, and sedentary lifestyle are environmental risk factors for NIHL. Concurrence of NRN1 rs3805789 and CAT rs7943316 constitutes a genetic risk factor for NIHL. Complex noise exposure significantly increases the risk of NIHL in subjects with a high genetic risk score. Interactions between genes and lifestyle as well as noise metrics and lifestyle affect the risk of NIHL. These results provide a theoretical basis for screening genetic and environmental risk factors to prevent NIHL.

    • SYL and WQS are joint first authors. SYL oversaw data analysis and wrote the manuscript. WQS edited the article and JRX conducted the statistical analysis. ZL, SL, and YQC conducted the study design and revised the manuscript. TYZ, HYW, and LWX carried out the experiment. MBZ, YH, and LY was responsible for data collection and final manuscript. All authors approved the final manuscript.

    • The authors thank all the participants and institutions for their contribution to this study.

    • All the participants signed the informed consent form, and the study was approved by the Science Ethics Committee of Hangzhou Normal University (2017LL107).

    • The authors declare that they have no conflict of interest.

参考文献 (44)
补充材料:
20458.pdf

目录

    /

    返回文章
    返回